National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8037R-1 
 Symbol Su(Tpl)  Full Name Su(Tpl) 
 CG No CG32217  Old CG No CG8037 
 Synonyms l(3)76BDs, dELL, ELL, SR3-4A, SY3-1, SS3-4, Ell, l(3)S085401, 0854/01, l(3)S000606, CR32216, CG8037, CG32217, Su(Tpl) 
 Accession No (Link to NCBI) NM_140898.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCACTATCGACCGGCAATTA 
 Primer Seq. 3'
aatctagaggtaccCGATATCCGACTGATTCGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCACTATCG ACCGGCAATT ATGGAATGTC CCAGAGCCAC CGTTACACCG ATGATAGCAA 
0061 GGAGTACATC ATCGTCAAGC TTACCGATTC TGCCTTCCGT GCGATCGAGG AATATCAGCG 
0121 CGATGACAAC GCTAAACGCC TGCAACCAGG CCAAAGGGCC AAAATCCAAT TTGTTGGCAA 
0181 CACGGGTGTC ATACAGTTCC CGCGACCAGC GACGGATGCT AATGGCATCC CTAATGCTAA 
0241 TGGCAATGGC AGCGACGCGA NCTGGAGCAG GAGGAGGAGG TGGTAGAAAA TTTGGCTTCA 
0301 CTATCAACAA TATGGAGGGA ACGCTTGAAT GCGTTCAGCA GCAGCAACGG AGCCTCGGAG 
0361 TCCTCGGAGC GGTCACCCTG CGAATGCGGA TTCATGCCAA TGAAGATGTC TACGATTCGA 
0421 CACGCACAAA AATGGCCATT GCCGAGGAGA CGGAGAAGAG CAAGTGCATC AGGGAAATCA 
0481 AGCCGAATCA GTCGGATATC G 
 in silico PCR Fragment
0001 TGCACTATCG ACCGGCAATT ATGGAATGTC CCAGAGCCAC CGTTACACCG ATGATAGCAA 
0061 GGAGTACATC ATCGTCAAGC TTACCGATTC TGCCTTCCGT GCGATCGAGG AATATCAGCG 
0121 CGATGACAAC GCTAAACGCC TGCAACCAGG CCAAAGGGCC AAAATCCAAT TTGTGGGCAA 
0181 CACGGGTGTC ATACAGTTCC CGCGACCAGC GACGGATGCT AATGGCATCC CTAATGCTAA 
0241 TGGCAATGGC AGCGACGCGA -CTGGAGCAG GAGGAGGAGG TGGTAGAAAA TTTGGCTTCA 
0301 CTATCAACAA TATGGAGGGA ACGCTTGAAT GCGTTCAGCA GCAGCAACGG AGCCTCGGAG 
0361 TCCTCGGAGC GGTCACCCTG CGAATGCGGA TTCATGCCAA TGAAGATGTC TACGATTCGA 
0421 CACGCACAAA AATGGCCATT GCCGAGGAGA CGGAGAAGAG CAAGTGCATC AGGGAAATCA 
0481 AGCCGAATCA GTCGGATATC G 
 Assemble Data

8037R-1.IR_full       1   TGCACTATCGACCGGCAATTATGGAATGTCCCAGAGCCACCGTTACACCGATGATAGCAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     1   TGCACTATCGACCGGCAATTATGGAATGTCCCAGAGCCACCGTTACACCGATGATAGCAA 60


8037R-1.IR_full       61  GGAGTACATCATCGTCAAGCTTACCGATTCTGCCTTCCGTGCGATCGAGGAATATCAGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     61  GGAGTACATCATCGTCAAGCTTACCGATTCTGCCTTCCGTGCGATCGAGGAATATCAGCG 120


8037R-1.IR_full       121 CGATGACAACGCTAAACGCCTGCAACCAGGCCAAAGGGCCAAAATCCAATTTGTTGGCAA 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
8037R-1.in silico     121 CGATGACAACGCTAAACGCCTGCAACCAGGCCAAAGGGCCAAAATCCAATTTGTGGGCAA 180


8037R-1.IR_full       181 CACGGGTGTCATACAGTTCCCGCGACCAGCGACGGATGCTAATGGCATCCCTAATGCTAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     181 CACGGGTGTCATACAGTTCCCGCGACCAGCGACGGATGCTAATGGCATCCCTAATGCTAA 240


8037R-1.IR_full       241 TGGCAATGGCAGCGACGCGANCTGGAGCAGGAGGAGGAGGTGGTAGAAAATTTGGCTTCA 300
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     241 TGGCAATGGCAGCGACGCGA-CTGGAGCAGGAGGAGGAGGTGGTAGAAAATTTGGCTTCA 300


8037R-1.IR_full       301 CTATCAACAATATGGAGGGAACGCTTGAATGCGTTCAGCAGCAGCAACGGAGCCTCGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     301 CTATCAACAATATGGAGGGAACGCTTGAATGCGTTCAGCAGCAGCAACGGAGCCTCGGAG 360


8037R-1.IR_full       361 TCCTCGGAGCGGTCACCCTGCGAATGCGGATTCATGCCAATGAAGATGTCTACGATTCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     361 TCCTCGGAGCGGTCACCCTGCGAATGCGGATTCATGCCAATGAAGATGTCTACGATTCGA 420


8037R-1.IR_full       421 CACGCACAAAAATGGCCATTGCCGAGGAGACGGAGAAGAGCAAGTGCATCAGGGAAATCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8037R-1.in silico     421 CACGCACAAAAATGGCCATTGCCGAGGAGACGGAGAAGAGCAAGTGCATCAGGGAAATCA 480


8037R-1.IR_full       481 AGCCGAATCAGTCGGATATCG 501
                          |||||||||||||||||||||
8037R-1.in silico     481 AGCCGAATCAGTCGGATATCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0.41   NM_169202.1  CG11094-RA, transcript variant A (dsx), mRNA 
0.41   NM_138073.1  CG13579-RA (CG13579), mRNA 
0   12  NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   12  NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
0   12  NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
0   12  NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
0   12  NM_143089.2  CG11849-RA (dan), mRNA 
0   14  35  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   14  35  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   15  NM_139420.1  CG12361-RA (CG12361), mRNA 
0   17  NM_132525.1  CG15740-RA (CG15740), mRNA 
0   10  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   10  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   14  25  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   10  12  NM_144026.1  CG11458-RA (CG11458), mRNA 
0   14  32  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   12  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_205937.1  CG13394-RB, transcript variant B (CG13394), mRNA 
0   NM_135380.3  CG13394-RA, transcript variant A (CG13394), mRNA 
0   NM_142201.1  CG14868-RA (CG14868), mRNA 
0   NM_135265.1  CG4971-RA (Wnt10), mRNA 
0   NM_136633.2  CG2072-RA (TXBP181-like), mRNA 
0   11  NM_079317.2  CG10704-RA (toe), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.