National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8025R-2 
 Symbol Mtr3  Full Name Mtr3 
 CG No CG8025  Old CG No CG8025 
 Synonyms CG8025, dMtr3, Mtr3 
 Accession No (Link to NCBI) NM_140900.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGATTCGGTGCCGGAACGGGA 
 Primer Seq. 3'
aatctagaggtaccCCGCTTCGTGAGCACGCCTTT 
 Predicted Fragment Size
496 
 IR fragment full Seq
0001 AGATTCGGTG CCGGAAcNGG AACGCCACCT GAGCAGCATG CTGACCAAGG CCATGGAGCC 
0061 GGNTGGTGTG CCGCACGGAG TTCCTTAACT TTCAGCTGGA CATACGGGTG CTTATTCTCG 
0121 ACGATGACGG CTGCCTGCTC AGCACTGCCA TCAATTGCTG CGGAGTCGCT TTGGTGGAGT 
0181 GCGGCATTTC CACTTACGAC TTAATTACGG CCTCCACAGC TTGTATCTAT CGGGATCACG 
0241 TCTTCCTGAA TCCCAGTGCC AAGGTTGAGG AGCTGCTCTG GAAGCATCGC AACAGCAGCA 
0301 CCGATAGCAC AACCAGCCCA TCATCCGCCC AGGAGCACGG CCTGATCATT ACCGCCAGCA 
0361 TGGATACCTT TGAACAGATC GCCCAGTGCC AGCAGTGCGG ATATCTCAGT CCAGCCACCT 
0421 ATGTAAAGCT GCTGGATTAC ACCCTGGCCA TTAACAAGTC CCTGAGAGAA CTAGTCAAAG 
0481 GCGTGCTCAC GANGCNG 
 in silico PCR Fragment
0001 AGATTCGGTG CCGGAACGGG AACGCCACCT GAGCAGCATG CTGACCAAGG CCATGGAGCC 
0061 GG-TGGTGTG CCGCACGGAG TTCCTTAACT TTCAGCTGGA CATACGGGTG CTTATTCTCG 
0121 ACGATGACGG CTGCCTGCTC AGCACTGCCA TCAATTGCTG CGGAGTCGCT TTGGTGGAGT 
0181 GCGGCATTTC CACTTACGAC TTAATTACGG CCTCCACAGC TTGTATCTAT CGGGATCACG 
0241 TCTTCCTGAA TCCCAGTGCC AAGGTTGAGG AGCTGCTCTG GAAGCATCGC AACAGCAGCA 
0301 CCGATAGCAC AACCAGCCCA TCATCCGCCC AGGAGCACGG CCTGATCATT ACCGCCAGCA 
0361 TGGATACCTT TGAACAGATC GCCCAGTGCC AGCAGTGCGG ATATCTCAGT CCAGCCACCT 
0421 ATGTAAAGCT GCTGGATTAC ACCCTGGCCA TTAACAAGTC CCTGAGAGAA CTAGTCAAAG 
0481 GCGTGCTCAC GAAGCGG 
 Assemble Data

8025R-2.IR_full       1   AGATTCGGTGCCGGAACNGGAACGCCACCTGAGCAGCATGCTGACCAAGGCCATGGAGCC 60
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     1   AGATTCGGTGCCGGAACGGGAACGCCACCTGAGCAGCATGCTGACCAAGGCCATGGAGCC 60


8025R-2.IR_full       61  GGNTGGTGTGCCGCACGGAGTTCCTTAACTTTCAGCTGGACATACGGGTGCTTATTCTCG 120
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     61  GG-TGGTGTGCCGCACGGAGTTCCTTAACTTTCAGCTGGACATACGGGTGCTTATTCTCG 120


8025R-2.IR_full       121 ACGATGACGGCTGCCTGCTCAGCACTGCCATCAATTGCTGCGGAGTCGCTTTGGTGGAGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     121 ACGATGACGGCTGCCTGCTCAGCACTGCCATCAATTGCTGCGGAGTCGCTTTGGTGGAGT 180


8025R-2.IR_full       181 GCGGCATTTCCACTTACGACTTAATTACGGCCTCCACAGCTTGTATCTATCGGGATCACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     181 GCGGCATTTCCACTTACGACTTAATTACGGCCTCCACAGCTTGTATCTATCGGGATCACG 240


8025R-2.IR_full       241 TCTTCCTGAATCCCAGTGCCAAGGTTGAGGAGCTGCTCTGGAAGCATCGCAACAGCAGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     241 TCTTCCTGAATCCCAGTGCCAAGGTTGAGGAGCTGCTCTGGAAGCATCGCAACAGCAGCA 300


8025R-2.IR_full       301 CCGATAGCACAACCAGCCCATCATCCGCCCAGGAGCACGGCCTGATCATTACCGCCAGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     301 CCGATAGCACAACCAGCCCATCATCCGCCCAGGAGCACGGCCTGATCATTACCGCCAGCA 360


8025R-2.IR_full       361 TGGATACCTTTGAACAGATCGCCCAGTGCCAGCAGTGCGGATATCTCAGTCCAGCCACCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     361 TGGATACCTTTGAACAGATCGCCCAGTGCCAGCAGTGCGGATATCTCAGTCCAGCCACCT 420


8025R-2.IR_full       421 ATGTAAAGCTGCTGGATTACACCCTGGCCATTAACAAGTCCCTGAGAGAACTAGTCAAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8025R-2.in silico     421 ATGTAAAGCTGCTGGATTACACCCTGGCCATTAACAAGTCCCTGAGAGAACTAGTCAAAG 480


8025R-2.IR_full       481 GCGTGCTCACGANGCNG 497
                          |||||||||||| || |
8025R-2.in silico     481 GCGTGCTCACGAAGCGG 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_140900.2  CG8025-RA (Mtr3), mRNA 
0.2   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0.2   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0.2   NM_168201.2  CG8598-RB, transcript variant B (eco), mRNA 
0.2   NM_139849.2  CG8598-RA, transcript variant A (eco), mRNA 
0   NM_176737.1  CG9213-RA (CG9213), mRNA 
0   NM_142044.2  CG9588-RA (CG9588), mRNA 
0   NM_001038726.1  CG17131-RB, transcript variant B (SP71), mRNA 
0   NM_001031861.1  CG17131-RA, transcript variant A (SP71), mRNA 
0   NM_141169.2  CG10712-RA, transcript variant A (Chro), mRNA 
0   NM_168976.1  CG10712-RC, transcript variant C (Chro), mRNA 
0   NM_168975.1  CG10712-RB, transcript variant B (Chro), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_132216.2  CG2116-RA (CG2116), mRNA 
0   NM_079586.2  CG6598-RA (Fdh), mRNA 
0   NM_137674.1  CG9993-RA (CG9993), mRNA 
0   11  NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
0   11  NM_001014527.1  CG8787-RB, transcript variant B (Asx), mRNA 
0   NM_137998.2  CG11183-RA (Dcp1), mRNA 
0   NM_137763.3  CG17922-RA (CG17922), mRNA 
0   NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0   NM_165881.1  CG8487-RA, transcript variant A (garz), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_080161.1  CG3496-RA (vir), mRNA 
0   NM_140240.1  CG6053-RA (CG6053), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.