National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8023R-2 
 Symbol eIF4E-3  Full Name eIF4E-3 
 CG No CG8023  Old CG No CG8023 
 Synonyms CG8023, anon-WO0140519.227, eIF4E-3 
 Accession No (Link to NCBI) NM_139937.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTGTACACCGGTTACGTA 
 Primer Seq. 3'
aatctagaggtaccTGCACAAAAGCAAATCGTGCC 
 Predicted Fragment Size
496 
 IR fragment full Seq
0001 ATGGTGTACA CCGGTTACGT AAGCAACGGA TTGCAGAATG TTGAGGAAAC TGCATGGGTG 
0061 CCGTATGGAG ATCCCAATGA CTGGTCACAT GGTCTGGCTG TTTATGATGG TTTGGAACTG 
0121 ATGAGCGGCA ATGAGGAGGA GTTGCAGCCC TCATTGAACC GGGTGATGAA AAACATCGAC 
0181 TACGACCTGG CCATGAAGCA TCCATTGGAG CATACCTGGA CTTTGTGGCA CTTGGAAAAC 
0241 GATCGTACCA AGCGCTGGGC CGAAATGCTC GTCGATGCGA CCAGCTTCAA CACCGTTGAG 
0301 GACTTCTTCA GTGTGTACTA CTTTGTGAAG CCGCCATCGG ATCTCAAGAT ATTCAATGAC 
0361 TACATGGTCT TCAAGAAAAA TATTCGTCCC ATGTGGGAGG ATGACACCAA TAAGAACGGT 
0421 GGTCGTTGGA TACTGCTCCT GGACAAGGCC TCCAGGACCT ATATAGATAA GATGTGGCAC 
0481 GATTTGCTTT TGTGCA 
 in silico PCR Fragment
0001 ATGGTGTACA CCGGTTACGT AAGCAACGGA TTGCAGAATG CTGAGGAAAC TGCATGGGTG 
0061 CCGTATGGAG ATCCCAATGA CTGGTCACAT GGTCTGGCAG TTTATGATGG TTTGGAACTG 
0121 ATGAGCGGCA ATGAGGAGGA GTTGCAGCCC TCATTGAACC GGGTGATGAA AAACATCGAC 
0181 TACGACCTGG CCATGAAGCA TCCATTGGAG CATACCTGGA CTTTGTGGCA CTTGGAGAAC 
0241 GATCGTACCA AGCGCTGGGC CGAAATGCTC GTCGATGTGA CCAGCTTCAA CACCGTTGAG 
0301 GACTTCTTCA GTGTGTACTA CTTTGTGAAG CCGCCATCGG ATCTGAAGAT ATTCAATGAC 
0361 TACATGGTCT TCAAGAAAAA TATTCGTCCC ATGTGGGAGG ATGACACCAA TAAGAACGGT 
0421 GGTCGTTGGA TACTGCTCCT GGACAAGGCC TCCAGGACCT ATATAGATAA GATGTGGCAC 
0481 GATTTGCTTT TGTGCA 
 Assemble Data

8023R-2.IR_full       1   ATGGTGTACACCGGTTACGTAAGCAACGGATTGCAGAATGTTGAGGAAACTGCATGGGTG 60
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
8023R-2.in silico     1   ATGGTGTACACCGGTTACGTAAGCAACGGATTGCAGAATGCTGAGGAAACTGCATGGGTG 60


8023R-2.IR_full       61  CCGTATGGAGATCCCAATGACTGGTCACATGGTCTGGCTGTTTATGATGGTTTGGAACTG 120
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
8023R-2.in silico     61  CCGTATGGAGATCCCAATGACTGGTCACATGGTCTGGCAGTTTATGATGGTTTGGAACTG 120


8023R-2.IR_full       121 ATGAGCGGCAATGAGGAGGAGTTGCAGCCCTCATTGAACCGGGTGATGAAAAACATCGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8023R-2.in silico     121 ATGAGCGGCAATGAGGAGGAGTTGCAGCCCTCATTGAACCGGGTGATGAAAAACATCGAC 180


8023R-2.IR_full       181 TACGACCTGGCCATGAAGCATCCATTGGAGCATACCTGGACTTTGTGGCACTTGGAAAAC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8023R-2.in silico     181 TACGACCTGGCCATGAAGCATCCATTGGAGCATACCTGGACTTTGTGGCACTTGGAGAAC 240


8023R-2.IR_full       241 GATCGTACCAAGCGCTGGGCCGAAATGCTCGTCGATGCGACCAGCTTCAACACCGTTGAG 300
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
8023R-2.in silico     241 GATCGTACCAAGCGCTGGGCCGAAATGCTCGTCGATGTGACCAGCTTCAACACCGTTGAG 300


8023R-2.IR_full       301 GACTTCTTCAGTGTGTACTACTTTGTGAAGCCGCCATCGGATCTCAAGATATTCAATGAC 360
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
8023R-2.in silico     301 GACTTCTTCAGTGTGTACTACTTTGTGAAGCCGCCATCGGATCTGAAGATATTCAATGAC 360


8023R-2.IR_full       361 TACATGGTCTTCAAGAAAAATATTCGTCCCATGTGGGAGGATGACACCAATAAGAACGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8023R-2.in silico     361 TACATGGTCTTCAAGAAAAATATTCGTCCCATGTGGGAGGATGACACCAATAAGAACGGT 420


8023R-2.IR_full       421 GGTCGTTGGATACTGCTCCTGGACAAGGCCTCCAGGACCTATATAGATAAGATGTGGCAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8023R-2.in silico     421 GGTCGTTGGATACTGCTCCTGGACAAGGCCTCCAGGACCTATATAGATAAGATGTGGCAC 480


8023R-2.IR_full       481 GATTTGCTTTTGTGCA 496
                          ||||||||||||||||
8023R-2.in silico     481 GATTTGCTTTTGTGCA 496

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_139937.1  CG8023-RA (eIF4E-3), mRNA 
0.83   10  21  NM_168337.1  CG4035-RF, transcript variant F (eIF-4E), mRNA 
0.83   10  21  NM_168336.1  CG4035-RE, transcript variant E (eIF-4E), mRNA 
0.83   10  21  NM_168338.1  CG4035-RG, transcript variant G (eIF-4E), mRNA 
0.83   10  21  NM_168334.1  CG4035-RA, transcript variant A (eIF-4E), mRNA 
0.83   10  21  NM_080090.2  CG4035-RB, transcript variant B (eIF-4E), mRNA 
0.83   10  21  NM_168333.1  CG4035-RC, transcript variant C (eIF-4E), mRNA 
0.83   10  21  NM_168335.1  CG4035-RD, transcript variant D (eIF-4E), mRNA 
0   NM_166870.1  CG32859-RA (eIF4E-7), mRNA 
0   13  NM_143397.2  CG1442-RA (eIF4E-6), mRNA 
0   NM_132465.2  CG1397-RA (CG1397), mRNA 
0   NM_140364.2  CG11259-RA (MICAL-like), mRNA 
0   NM_134705.2  CG3662-RA, transcript variant A (CG3662), mRNA 
0   NM_001038778.1  CG3662-RB, transcript variant B (CG3662), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_166585.2  CG30189-RA (Gr59a), mRNA 
0   NM_057313.3  CG3736-RA (okr), mRNA 
0   NM_169233.1  CG9786-RA, transcript variant A (hb), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_134770.1  CG17657-RA (CG17657), mRNA 
0   NM_079090.2  CG3668-RA (fd59A), mRNA 
0   NM_141337.1  CG2031-RA (Hpr1), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   18  28  NM_139903.1  CG8277-RA (eIF4E-5), mRNA 
0   NM_137372.2  CG6520-RA (CG6520), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   23  NM_139795.1  CG10124-RA (eIF4E-4), mRNA 
0   NM_057733.3  CG5210-RA (Chit), mRNA 
0   NM_133156.1  CG12202-RA (Nat1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.