National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8006R-2 
 Symbol CG8006  Full Name CG8006 
 CG No CG8006  Old CG No CG8006 
 Synonyms CG8006 
 Accession No (Link to NCBI) NM_139934.3 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGGATCGCCATTTCAGGCA 
 Primer Seq. 3'
aatctagaggtaccCACCATTTGGGGACTCGAAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGGATCGC CATTTCAGGC AGCAGCTAGC CAGTTACAAG TATGCCGATC AGgcaAGGGC 
0061 TAAGCAGTCG GATCGCCCCA TCATGGCCAG ATGGATAAAG ATATTCGAGA AGGCTCCTCT 
0121 CAGCGAGAAG TTGGCCCGAA ATAGCCTGAT GCTGCTCATG CATGGCCACT TGAAGGACTT 
0181 TGGAGTGCTC AAGGAACCGT TCACGNATGT GCGTAACTAC AGTAGGAATC TGAACGTAAT 
0241 TTTGGATGAG TACAGAGGCC AGCCATGTAA GAAGTTGGAT ACTGGCAAAT CACCTACACT 
0301 GCTCAAGAAG TGCTCGACTC AAATTTTACG ACCCAGGAAA CTGGAACCCA TCAAGGAGGT 
0361 TTCCGAACAC TCGGAAAAGG AGCCTACGAC CAGTAGTTTT GCCAGCATTG TGACGATAAT 
0421 ACGAAAAACA AATACGCGAT CCTCTGACTC GAAGGATAGC CAAGTTTATC CAAGGACTGG 
0481 CTTCGAGTCC CCAAATGGTG  
 in silico PCR Fragment
0001 ACTGGATCGC CATTTCAGGC AGCAGCTAGC CAGTTACAAG TATGCCGATC AGGCAAGGGC 
0061 TAAGCAGTCG GATCGCCCCA TCATGGCCAG ATGGATAAAG ATATTCGAGA AGGCTCCTCT 
0121 CAGCGAGAAG TTGGCCCGAA ATAGCCTGAT GCTGCTCATG CATGGCCACT TGAAGGACTT 
0181 TGGAGTGCTC AAGGAACCGT TCACGGATGT GCGTAACTAC AGTAGGAATC TGAACGTAAT 
0241 TTTGGATGAG TACAGAGGCC AGCCATGTAA GAAGTTAGCT ACTGGCAAAT CACCTACACT 
0301 GCTCAAGAAG TGCTCGACTC AAATTTTACG ACCCAGGAAA CTGGAACCCA TCAAGGAGGT 
0361 TTCCGAACAA TCGGAAAATG ATCCTACGAC CAGTAGTTTT GCCAGCATTG TGACAATAAT 
0421 ACGAAAAACA AATACGCGAT CCTCTGACTC GAAGGATAGC CAAGTTTATC CAAGGACTGG 
0481 CTTCGAGTCC CCAAATGGTG  
 Assemble Data

8006R-2.IR_full       1   ACTGGATCGCCATTTCAGGCAGCAGCTAGCCAGTTACAAGTATGCCGATCAGGCAAGGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8006R-2.in silico     1   ACTGGATCGCCATTTCAGGCAGCAGCTAGCCAGTTACAAGTATGCCGATCAGGCAAGGGC 60


8006R-2.IR_full       61  TAAGCAGTCGGATCGCCCCATCATGGCCAGATGGATAAAGATATTCGAGAAGGCTCCTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8006R-2.in silico     61  TAAGCAGTCGGATCGCCCCATCATGGCCAGATGGATAAAGATATTCGAGAAGGCTCCTCT 120


8006R-2.IR_full       121 CAGCGAGAAGTTGGCCCGAAATAGCCTGATGCTGCTCATGCATGGCCACTTGAAGGACTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8006R-2.in silico     121 CAGCGAGAAGTTGGCCCGAAATAGCCTGATGCTGCTCATGCATGGCCACTTGAAGGACTT 180


8006R-2.IR_full       181 TGGAGTGCTCAAGGAACCGTTCACGNATGTGCGTAACTACAGTAGGAATCTGAACGTAAT 240
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
8006R-2.in silico     181 TGGAGTGCTCAAGGAACCGTTCACGGATGTGCGTAACTACAGTAGGAATCTGAACGTAAT 240


8006R-2.IR_full       241 TTTGGATGAGTACAGAGGCCAGCCATGTAAGAAGTTGGATACTGGCAAATCACCTACACT 300
                          |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||
8006R-2.in silico     241 TTTGGATGAGTACAGAGGCCAGCCATGTAAGAAGTTAGCTACTGGCAAATCACCTACACT 300


8006R-2.IR_full       301 GCTCAAGAAGTGCTCGACTCAAATTTTACGACCCAGGAAACTGGAACCCATCAAGGAGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8006R-2.in silico     301 GCTCAAGAAGTGCTCGACTCAAATTTTACGACCCAGGAAACTGGAACCCATCAAGGAGGT 360


8006R-2.IR_full       361 TTCCGAACACTCGGAAAAGGAGCCTACGACCAGTAGTTTTGCCAGCATTGTGACGATAAT 420
                          ||||||||| |||||||| || |||||||||||||||||||||||||||||||| |||||
8006R-2.in silico     361 TTCCGAACAATCGGAAAATGATCCTACGACCAGTAGTTTTGCCAGCATTGTGACAATAAT 420


8006R-2.IR_full       421 ACGAAAAACAAATACGCGATCCTCTGACTCGAAGGATAGCCAAGTTTATCCAAGGACTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8006R-2.in silico     421 ACGAAAAACAAATACGCGATCCTCTGACTCGAAGGATAGCCAAGTTTATCCAAGGACTGG 480


8006R-2.IR_full       481 CTTCGAGTCCCCAAATGGTG 500
                          ||||||||||||||||||||
8006R-2.in silico     481 CTTCGAGTCCCCAAATGGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139934.3  CG8006-RA (CG8006), mRNA 
0   NM_079790.3  CG8384-RD, transcript variant D (gro), mRNA 
0   NM_170254.1  CG8384-RA, transcript variant A (gro), mRNA 
0   NM_170255.2  CG8384-RB, transcript variant B (gro), mRNA 
0   NM_206575.1  CG8384-RE, transcript variant E (gro), mRNA 
0   NM_170256.1  CG8384-RC, transcript variant C (gro), mRNA 
0   NM_140714.3  CG6456-RA (Mip), mRNA 
0   NM_132298.3  CG7039-RA (CG7039), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_164960.1  CG32830-RA (CG32830), mRNA 
0   NM_144143.2  CG14767-RA, transcript variant A (CG14767), mRNA 
0   NM_165619.1  CG14767-RB, transcript variant B (CG14767), mRNA 
0   NM_165620.1  CG14767-RC, transcript variant C (CG14767), mRNA 
0   NM_078495.1  CG15779-RA (Tre), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_078809.2  CG4916-RA, transcript variant A (me31B), mRNA 
0   NM_164898.1  CG4916-RB, transcript variant B (me31B), mRNA 
0   NM_132876.3  CG9214-RA, transcript variant A (Tob), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_176122.1  CG33183-RB, transcript variant B (Hr46), mRNA 
0   NM_176123.1  CG33183-RA, transcript variant A (Hr46), mRNA 
0   10  NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   10  NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   10  NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_166720.1  CG17964-RD, transcript variant D (pan), mRNA 
0   NM_166718.1  CG17964-RA, transcript variant A (pan), mRNA 
0   NM_166719.1  CG17964-RC, transcript variant C (pan), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.