National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8006R-1 
 Symbol CG8006  Full Name CG8006 
 CG No CG8006  Old CG No CG8006 
 Synonyms CG8006 
 Accession No (Link to NCBI) NM_139934.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTGGATCGCCATTTCAGGCAGCAGCTAGCCAGTTACAAGTATGCCGATCAGGCAAGGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TAAGCAGTCGGATCGCCCCATCATGGCCAGATGGATAAAGATATTCGAGAAGGCTCCTCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGCGAGAAGTTGGCCCGAAATAGCCTGATGCTGCTCATGCATGGCCACTTGAAGGACTT 180

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     181 TGGAGTGCTCAAGGAACCGTTCACGGATGTGCGTAACTACAGTAGGAATCTGAACGTAAT 240

                          |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| silico     241 TTTGGATGAGTACAGAGGCCAGCCATGTAAGAAGTTAGCTACTGGCAAATCACCTACACT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCTCAAGAAGTGCTCGACTCAAATTTTACGACCCAGGAAACTGGAACCCATCAAGGAGGT 360

                          ||||||||| |||||||| || |||||||||||||||||||||||||||||||| ||||| silico     361 TTCCGAACAATCGGAAAATGATCCTACGACCAGTAGTTTTGCCAGCATTGTGACAATAAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGAAAAACAAATACGCGATCCTCTGACTCGAAGGATAGCCAAGTTTATCCAAGGACTGG 480

8006R-1.IR_full       481 CTTCGAGTCCCCAAATGGTG 500
                          |||||||||||||||||||| silico     481 CTTCGAGTCCCCAAATGGTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139934.3  CG8006-RA (CG8006), mRNA 
0   NM_079790.3  CG8384-RD, transcript variant D (gro), mRNA 
0   NM_170254.1  CG8384-RA, transcript variant A (gro), mRNA 
0   NM_170255.2  CG8384-RB, transcript variant B (gro), mRNA 
0   NM_206575.1  CG8384-RE, transcript variant E (gro), mRNA 
0   NM_170256.1  CG8384-RC, transcript variant C (gro), mRNA 
0   NM_140714.3  CG6456-RA (Mip), mRNA 
0   NM_132298.3  CG7039-RA (CG7039), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_164960.1  CG32830-RA (CG32830), mRNA 
0   NM_144143.2  CG14767-RA, transcript variant A (CG14767), mRNA 
0   NM_165619.1  CG14767-RB, transcript variant B (CG14767), mRNA 
0   NM_165620.1  CG14767-RC, transcript variant C (CG14767), mRNA 
0   NM_078495.1  CG15779-RA (Tre), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_078809.2  CG4916-RA, transcript variant A (me31B), mRNA 
0   NM_164898.1  CG4916-RB, transcript variant B (me31B), mRNA 
0   NM_132876.3  CG9214-RA, transcript variant A (Tob), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_176122.1  CG33183-RB, transcript variant B (Hr46), mRNA 
0   NM_176123.1  CG33183-RA, transcript variant A (Hr46), mRNA 
0   10  NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   10  NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   10  NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_166720.1  CG17964-RD, transcript variant D (pan), mRNA 
0   NM_166718.1  CG17964-RA, transcript variant A (pan), mRNA 
0   NM_166719.1  CG17964-RC, transcript variant C (pan), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.