National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8003R-3 
 Symbol CG8003  Full Name CG8003 
 CG No CG8003  Old CG No CG8003 
 Synonyms CG8003 
 Accession No (Link to NCBI) NM_140149.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGACCGAGGAAAGCAAGAAGATCGTACAGCTGGACGACGTGCAGCGCCAGTTGCTGGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CATCTGGCCAAGAATGACACCAGTGGATTCAAGCAGCTGCTGAGCGGAGTGAGGAATGTT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AATTTCGTGGACGACACCGGGATGTCGTGTTTGGCCCACGCCAGCTTCAAGGGAAACCGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGGCGGTGCAGCTGCTCCTGGACATGGGTGCCGACATAAACCTCAATCAGCATGGAGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATTATACGCCACTGCATTTCGCCGCTCTATCGGGCAATACACATGTGTGCCGGCTTCTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGGATGCTGGCATCAAGCCGGGTAGCATCAATAGTGTCAACAGGACCGCCGCCCAAATG 360

                          |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     361 GCCGCCTTTGTGGGCAACCACGCCTGCGTGGAGACCATCAACAACTATGTGACCCAGTCG 420

                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || silico     421 AGTTTGGAGTACTACACCCAAGTGCATGGCCAGCA-GACGGAGCCGCATATACCACCCAG 480

8003R-3.IR_full       481 CTTACTCAAATCGTTCCACGC 501
                          ||||||||||||||||||||| silico     481 CTTACTCAAATCGTTCCACGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140149.2  CG8003-RA (CG8003), mRNA 
0.82   NM_142399.1  CG7379-RA (CG7379), mRNA 
0.41   NM_135341.1  CG8552-RA (CG8552), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_176331.1  CG33209-RA (comm3), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_135444.3  CG4435-RA (FucTB), mRNA 
0   NM_206717.2  CG9220-RC (CG9220), mRNA 
0   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_001014481.1  CG7147-RC, transcript variant C (kuz), mRNA 
0   NM_165047.1  CG7147-RB, transcript variant B (kuz), mRNA 
0   NM_057839.3  CG7147-RA, transcript variant A (kuz), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_164378.1  CG3625-RA, transcript variant A (CG3625), mRNA 
0   NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_057911.3  CG6382-RA (Elf), mRNA 
0   NM_176522.1  CG32491-RZ, transcript variant Z (mod(mdg4)), mRNA 
0   NM_057318.3  CG11579-RA, transcript variant A (arm), mRNA 
0   NM_057317.3  CG11579-RD, transcript variant D (arm), mRNA 
0   NM_166912.2  CG11579-RC, transcript variant C (arm), mRNA 
0   NM_134273.2  CG11579-RB, transcript variant B (arm), mRNA 
0   NM_206605.1  CG11579-RE, transcript variant E (arm), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_130560.2  CG14789-RA (O-fut2), mRNA 
0   NM_166167.2  CG4311-RC, transcript variant C (Hmgs), mRNA 
0   NM_166166.2  CG4311-RB, transcript variant B (Hmgs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.