National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8003R-1 
 Symbol CG8003  Full Name CG8003 
 CG No CG8003  Old CG No CG8003 
 Synonyms CG8003 
 Accession No (Link to NCBI) NM_140149.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACCGAGGAAAGCAAGAAG 
 Primer Seq. 3'
aatctagaggtaccGCGTGGAACGATTTGAGTAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGACCGAGG AAAGCAAGAA GATCGTACAG CTGGACGACG TGCAGCGCCA GTTGCTGGAT 
0061 CATCTGGCCA AGAATGACAC CAGTGGATTC AAGCAGCTGC TGAGCGGAGT GAGGAATGTT 
0121 AATTTCGTGG ACGACACCGG GATGTCGTGT TTGGCCCACG CCAGCTTCAA GGGAAACCGC 
0181 GAGGCGGTGC AGCTGCTCCT GGACATGGGT GCCGACATAA ACCTCAATCA GCATGGAGCT 
0241 GATTATACGC CACTGCATTT CGCCGCTCTA TCGGGCAATA CACATGTGTG CCGGCTTCTT 
0301 TTGGATGCTG GCATCAAGCC GGGTAGCATC AATAGTGTCA ACAGGACCGC CGCCCAAATG 
0361 GCCGCCTTTG TGGGCAACCA CGCCTGTGTG GAGACCATCA ACAACTATGT GACCCAGTCG 
0421 AGTTTGGAGT ACTACACCCA AGTGCATGGC CAGCANGACG GAGCCGCATA TACCACCTAG 
0481 CTTACTCAAA TCGTTCCACG C 
 in silico PCR Fragment
0001 ATGACCGAGG AAAGCAAGAA GATCGTACAG CTGGACGACG TGCAGCGCCA GTTGCTGGAT 
0061 CATCTGGCCA AGAATGACAC CAGTGGATTC AAGCAGCTGC TGAGCGGAGT GAGGAATGTT 
0121 AATTTCGTGG ACGACACCGG GATGTCGTGT TTGGCCCACG CCAGCTTCAA GGGAAACCGC 
0181 GAGGCGGTGC AGCTGCTCCT GGACATGGGT GCCGACATAA ACCTCAATCA GCATGGAGCT 
0241 GATTATACGC CACTGCATTT CGCCGCTCTA TCGGGCAATA CACATGTGTG CCGGCTTCTT 
0301 TTGGATGCTG GCATCAAGCC GGGTAGCATC AATAGTGTCA ACAGGACCGC CGCCCAAATG 
0361 GCCGCCTTTG TGGGCAACCA CGCCTGCGTG GAGACCATCA ACAACTATGT GACCCAGTCG 
0421 AGTTTGGAGT ACTACACCCA AGTGCATGGC CAGCA-GACG GAGCCGCATA TACCACCCAG 
0481 CTTACTCAAA TCGTTCCACG C 
 Assemble Data

8003R-1.IR_full       1   ATGACCGAGGAAAGCAAGAAGATCGTACAGCTGGACGACGTGCAGCGCCAGTTGCTGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     1   ATGACCGAGGAAAGCAAGAAGATCGTACAGCTGGACGACGTGCAGCGCCAGTTGCTGGAT 60


8003R-1.IR_full       61  CATCTGGCCAAGAATGACACCAGTGGATTCAAGCAGCTGCTGAGCGGAGTGAGGAATGTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     61  CATCTGGCCAAGAATGACACCAGTGGATTCAAGCAGCTGCTGAGCGGAGTGAGGAATGTT 120


8003R-1.IR_full       121 AATTTCGTGGACGACACCGGGATGTCGTGTTTGGCCCACGCCAGCTTCAAGGGAAACCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     121 AATTTCGTGGACGACACCGGGATGTCGTGTTTGGCCCACGCCAGCTTCAAGGGAAACCGC 180


8003R-1.IR_full       181 GAGGCGGTGCAGCTGCTCCTGGACATGGGTGCCGACATAAACCTCAATCAGCATGGAGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     181 GAGGCGGTGCAGCTGCTCCTGGACATGGGTGCCGACATAAACCTCAATCAGCATGGAGCT 240


8003R-1.IR_full       241 GATTATACGCCACTGCATTTCGCCGCTCTATCGGGCAATACACATGTGTGCCGGCTTCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     241 GATTATACGCCACTGCATTTCGCCGCTCTATCGGGCAATACACATGTGTGCCGGCTTCTT 300


8003R-1.IR_full       301 TTGGATGCTGGCATCAAGCCGGGTAGCATCAATAGTGTCAACAGGACCGCCGCCCAAATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8003R-1.in silico     301 TTGGATGCTGGCATCAAGCCGGGTAGCATCAATAGTGTCAACAGGACCGCCGCCCAAATG 360


8003R-1.IR_full       361 GCCGCCTTTGTGGGCAACCACGCCTGTGTGGAGACCATCAACAACTATGTGACCCAGTCG 420
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
8003R-1.in silico     361 GCCGCCTTTGTGGGCAACCACGCCTGCGTGGAGACCATCAACAACTATGTGACCCAGTCG 420


8003R-1.IR_full       421 AGTTTGGAGTACTACACCCAAGTGCATGGCCAGCANGACGGAGCCGCATATACCACCTAG 480
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||
8003R-1.in silico     421 AGTTTGGAGTACTACACCCAAGTGCATGGCCAGCA-GACGGAGCCGCATATACCACCCAG 480


8003R-1.IR_full       481 CTTACTCAAATCGTTCCACGC 501
                          |||||||||||||||||||||
8003R-1.in silico     481 CTTACTCAAATCGTTCCACGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140149.2  CG8003-RA (CG8003), mRNA 
0.82   NM_142399.1  CG7379-RA (CG7379), mRNA 
0.41   NM_135341.1  CG8552-RA (CG8552), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_176331.1  CG33209-RA (comm3), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_135444.3  CG4435-RA (FucTB), mRNA 
0   NM_206717.2  CG9220-RC (CG9220), mRNA 
0   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_001014481.1  CG7147-RC, transcript variant C (kuz), mRNA 
0   NM_165047.1  CG7147-RB, transcript variant B (kuz), mRNA 
0   NM_057839.3  CG7147-RA, transcript variant A (kuz), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_164378.1  CG3625-RA, transcript variant A (CG3625), mRNA 
0   NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_057911.3  CG6382-RA (Elf), mRNA 
0   NM_176522.1  CG32491-RZ, transcript variant Z (mod(mdg4)), mRNA 
0   NM_057318.3  CG11579-RA, transcript variant A (arm), mRNA 
0   NM_057317.3  CG11579-RD, transcript variant D (arm), mRNA 
0   NM_166912.2  CG11579-RC, transcript variant C (arm), mRNA 
0   NM_134273.2  CG11579-RB, transcript variant B (arm), mRNA 
0   NM_206605.1  CG11579-RE, transcript variant E (arm), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_130560.2  CG14789-RA (O-fut2), mRNA 
0   NM_166167.2  CG4311-RC, transcript variant C (Hmgs), mRNA 
0   NM_166166.2  CG4311-RB, transcript variant B (Hmgs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.