National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7999R-2 
 Symbol MED24  Full Name Mediator complex subunit 24 
 CG No CG7999  Old CG No CG7999 
 Synonyms Trap100, Med24, dTRAP100, CG7999, MED24 
 Accession No (Link to NCBI) NM_139928.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGATGCAGCAGGCACTCATTG 
 Primer Seq. 3'
aatctagaggtaccCACTTGTGGTGCATTTAGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGATGCAGCA GGCACTCATT GGTTCCACGG CTAATCCGTT GGTTCTTAAC TACCTGAAGC 
0061 ATTCACTGTG CGCCCATCTC GTTTCTCACG CTGCTGTTAT TCGGTGCATT GCCAAATATG 
0121 ACAAATTAGA GCGCGTTTAT TGCATTACAG CGCTCCTTGA ATTCCTGGCC AGCATCGTGG 
0181 ATGGCGTTAC CTGCCGAATA AAATCTGAGG AAGCGGTTTT ACCGAGTTCC GTCGTCCACT 
0241 TGGTGTACTG GCTGCTTCAA ATCTTCGCCA GAACTGTGCA GCACTATGAA CTGTATGGTG 
0301 AGATTAGTGC TGAGCAATCA TACATGCTGG ACCAGACCTG CGTGGTGATA GATCGGCTTA 
0361 GCCAGCAGCA GTTCCTGCTG TCNTATGCTG TACGTGGGCT GTCACGAAGA GCTCGAAATA 
0421 TGTGGACGGA TTCGGGATAA GTACGCTACC ATCAAGGGAT CGTTGACGAA CTCAAACTTT 
0481 ACGCTAAATG CANCACAAGT G 
 in silico PCR Fragment
0001 TGATGCAGCA GGCACTCATT GGTTCCACGG CTAATCCGTT GGTTCTTAAC TACCTGAAGC 
0061 ATTCACTGTG CGCCCATCTC GTTTCTCACG CTGCTGTTAT TCGGTGCATT GCCAAATATG 
0121 ACAAATTAGA GCGCGTTTAT TGCATTACAG CGCTCCTTGA ATTCCTGGCC AGCATCGTGG 
0181 ATGGCGTTAC CTGCCGAATA AAATCTGAGG AAGCGGTTTT ACCGAGTTCC GTCGTCCACT 
0241 TGGTGTACTG GCTGCTTCAA ATCTTCGCCA GAACTGTGCA GCACTATGAA CTGTATGGTG 
0301 AGATTAGTGC TGAGCAATCA TACATGCTGG ACCAGACCTG CGTGGTGATA GATCGGCTTA 
0361 GCCAGCAGCA GTTCCTGCTG TC-TATGCTG TACGTGGGCT GTCACGAAGA GCTCGAAATA 
0421 TGTGGACGGA TTCGGGATAA GTACGCTACC ATCAAGGGAT CGTTGACGAA CTCAAACTTT 
0481 ACGCTAAATG CACCACAAGT G 
 Assemble Data

7999R-2.IR_full       1   TGATGCAGCAGGCACTCATTGGTTCCACGGCTAATCCGTTGGTTCTTAACTACCTGAAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     1   TGATGCAGCAGGCACTCATTGGTTCCACGGCTAATCCGTTGGTTCTTAACTACCTGAAGC 60


7999R-2.IR_full       61  ATTCACTGTGCGCCCATCTCGTTTCTCACGCTGCTGTTATTCGGTGCATTGCCAAATATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     61  ATTCACTGTGCGCCCATCTCGTTTCTCACGCTGCTGTTATTCGGTGCATTGCCAAATATG 120


7999R-2.IR_full       121 ACAAATTAGAGCGCGTTTATTGCATTACAGCGCTCCTTGAATTCCTGGCCAGCATCGTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     121 ACAAATTAGAGCGCGTTTATTGCATTACAGCGCTCCTTGAATTCCTGGCCAGCATCGTGG 180


7999R-2.IR_full       181 ATGGCGTTACCTGCCGAATAAAATCTGAGGAAGCGGTTTTACCGAGTTCCGTCGTCCACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     181 ATGGCGTTACCTGCCGAATAAAATCTGAGGAAGCGGTTTTACCGAGTTCCGTCGTCCACT 240


7999R-2.IR_full       241 TGGTGTACTGGCTGCTTCAAATCTTCGCCAGAACTGTGCAGCACTATGAACTGTATGGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     241 TGGTGTACTGGCTGCTTCAAATCTTCGCCAGAACTGTGCAGCACTATGAACTGTATGGTG 300


7999R-2.IR_full       301 AGATTAGTGCTGAGCAATCATACATGCTGGACCAGACCTGCGTGGTGATAGATCGGCTTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     301 AGATTAGTGCTGAGCAATCATACATGCTGGACCAGACCTGCGTGGTGATAGATCGGCTTA 360


7999R-2.IR_full       361 GCCAGCAGCAGTTCCTGCTGTCNTATGCTGTACGTGGGCTGTCACGAAGAGCTCGAAATA 420
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
7999R-2.in silico     361 GCCAGCAGCAGTTCCTGCTGTC-TATGCTGTACGTGGGCTGTCACGAAGAGCTCGAAATA 420


7999R-2.IR_full       421 TGTGGACGGATTCGGGATAAGTACGCTACCATCAAGGGATCGTTGACGAACTCAAACTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7999R-2.in silico     421 TGTGGACGGATTCGGGATAAGTACGCTACCATCAAGGGATCGTTGACGAACTCAAACTTT 480


7999R-2.IR_full       481 ACGCTAAATGCANCACAAGTG 501
                          |||||||||||| ||||||||
7999R-2.in silico     481 ACGCTAAATGCACCACAAGTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139928.3  CG7999-RA (MED24), mRNA 
0   NM_135693.1  CG6766-RA (CG6766), mRNA 
0   NM_132988.2  CG12993-RA (CG12993), mRNA 
0   NM_137045.2  CG13335-RB, transcript variant B (CG13335), mRNA 
0   NM_166009.1  CG13335-RA, transcript variant A (CG13335), mRNA 
0   NM_168129.1  CG5486-RA, transcript variant A (Ubp64E), mRNA 
0   NM_206279.1  CG5486-RC, transcript variant C (Ubp64E), mRNA 
0   NM_079213.2  CG5486-RB, transcript variant B (Ubp64E), mRNA 
0   NM_138145.2  CG3776-RA (CG3776), mRNA 
0   NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
0   NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
0   NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
0   NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
0   NM_135075.2  CG14030-RA (CG14030), mRNA 
0   NM_132034.1  CG3108-RA (CG3108), mRNA 
0   NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
0   NM_080112.1  CG1857-RA (nec), mRNA 
0   NM_135466.2  CG17633-RA (CG17633), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_167957.1  CG12002-RB, transcript variant B (Pxn), mRNA 
0   NM_206254.1  CG12002-RD, transcript variant D (Pxn), mRNA 
0   NM_206255.1  CG12002-RC, transcript variant C (Pxn), mRNA 
0   NM_206253.1  CG12002-RE, transcript variant E (Pxn), mRNA 
0   NM_079167.3  CG12002-RA, transcript variant A (Pxn), mRNA 
0   NM_141446.1  CG10055-RA (CG10055), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0   NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0   NM_141009.2  CG32432-RA (CG32432), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.