National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7999R-1 
 Symbol MED24  Full Name Mediator complex subunit 24 
 CG No CG7999  Old CG No CG7999 
 Synonyms Trap100, Med24, dTRAP100, CG7999, MED24 
 Accession No (Link to NCBI) NM_139928.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGATGCAGCAGGCACTCATTGGTTCCACGGCTAATCCGTTGGTTCTTAACTACCTGAAGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATTCACTGTGCGCCCATCTCGTTTCTCACGCTGCTGTTATTCGGTGCATTGCCAAATATG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAAATTAGAGCGCGTTTATTGCATTACAGCGCTCCTTGAATTCCTGGCCAGCATCGTGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGGCGTTACCTGCCGAATAAAATCTGAGGAAGCGGTTTTACCGAGTTCCGTCGTCCACT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGTGTACTGGCTGCTTCAAATCTTCGCCAGAACTGTGCAGCACTATGAACTGTATGGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGATTAGTGCTGAGCAATCATACATGCTGGACCAGACCTGCGTGGTGATAGATCGGCTTA 360

                          |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     361 GCCAGCAGCAGTTCCTGCTGTC-TATGCTGTACGTGGGCTGTCACGAAGAGCTCGAAATA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTGGACGGATTCGGGATAAGTACGCTACCATCAAGGGATCGTTGACGAACTCAAACTTT 480

7999R-1.IR_full       481 ACGCTAAATGCANCACAAGTG 501
                          |||||||||||| |||||||| silico     481 ACGCTAAATGCACCACAAGTG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139928.3  CG7999-RA (MED24), mRNA 
0   NM_135693.1  CG6766-RA (CG6766), mRNA 
0   NM_132988.2  CG12993-RA (CG12993), mRNA 
0   NM_137045.2  CG13335-RB, transcript variant B (CG13335), mRNA 
0   NM_166009.1  CG13335-RA, transcript variant A (CG13335), mRNA 
0   NM_168129.1  CG5486-RA, transcript variant A (Ubp64E), mRNA 
0   NM_206279.1  CG5486-RC, transcript variant C (Ubp64E), mRNA 
0   NM_079213.2  CG5486-RB, transcript variant B (Ubp64E), mRNA 
0   NM_138145.2  CG3776-RA (CG3776), mRNA 
0   NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
0   NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
0   NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
0   NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
0   NM_135075.2  CG14030-RA (CG14030), mRNA 
0   NM_132034.1  CG3108-RA (CG3108), mRNA 
0   NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
0   NM_080112.1  CG1857-RA (nec), mRNA 
0   NM_135466.2  CG17633-RA (CG17633), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_167957.1  CG12002-RB, transcript variant B (Pxn), mRNA 
0   NM_206254.1  CG12002-RD, transcript variant D (Pxn), mRNA 
0   NM_206255.1  CG12002-RC, transcript variant C (Pxn), mRNA 
0   NM_206253.1  CG12002-RE, transcript variant E (Pxn), mRNA 
0   NM_079167.3  CG12002-RA, transcript variant A (Pxn), mRNA 
0   NM_141446.1  CG10055-RA (CG10055), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0   NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0   NM_141009.2  CG32432-RA (CG32432), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.