National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7979R-3 
 Symbol CG7979  Full Name CG7979 
 CG No CG7979  Old CG No CG7979 
 Synonyms CG7979 
 Accession No (Link to NCBI) NM_139925.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTGCCACCAAAAAGCGTCTGAAGATCGTTGCAGCCATCTCGCTGCTCCTCCTGCTCCTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCTACCTTTACCGAATGGCCAGCTTCTGCCCAAGCGGAAAGGTCGCCGTTTCCGTTCCC 120

                          ||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| silico     121 GGCGTCGAGGAGGTTCAGGCCAAATG--GCCGCCCACGGAAAGTCCGCTACAAAGGAGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCAGATGGCGTACGAGGAGCAGAGCTCTCTTATTCGAGAACAAAAGGCCGAACTCCAGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCACAAGGGAGAATTTGGCCAGATTGGAGGAACAAGTTCGTAGCCTCCAGACCAGCACAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCGCAAGTATCCGAAGGTTAAATACCTGAACTATAAGAATCGCAAACGCATACTAATTA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGGAGGAGCTGGCTTCGTGGGCTCCCACTTGGTCGACGATCTGATGGTCCAGGGGCACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGTCATCGTGGTGGACAATTTCTTTACGGGACGCAAGCGAAATGTCGAGCACTGGCTGG 480

7979R-3.IR_full       481 GGCACGAGAACTTCGAGCTCAT 502
                          |||||||||||||||||||||| silico     481 GGCACGAGAACTTCGAGCTCAT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139925.2  CG7979-RA (CG7979), mRNA 
0.2   NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0.2   NM_165053.1  CG31813-RA (CG31813), mRNA 
0   NM_167965.1  CG32296-RA (Mrtf), mRNA 
0   NM_168636.1  CG32150-RB, transcript variant B (CG32150), mRNA 
0   17  NM_132665.1  CG15753-RA (CG15753), mRNA 
0   NM_132350.1  CG15321-RA (CG15321), mRNA 
0   NM_138059.1  CG13575-RA (CG13575), mRNA 
0   NM_140962.1  CG13248-RA (CG13248), mRNA 
0   10  NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   10  NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_140022.1  CG5087-RA (CG5087), mRNA 
0   12  NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_057742.3  CG3269-RA (Rab2), mRNA 
0   NM_142033.1  CG14376-RA (CG14376), mRNA 
0   12  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   11  NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_137669.1  CG13443-RA (CG13443), mRNA 
0   14  NM_167188.1  CG32703-RA (CG32703), mRNA 
0   12  NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   10  NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   10  NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_166604.1  CG9812-RC, transcript variant C (CG9812), mRNA 
0   NM_167667.1  CG14217-RB, transcript variant B (Tao-1), mRNA 
0   NM_134475.2  CG14217-RA, transcript variant A (Tao-1), mRNA 
0   NM_167666.1  CG14217-RE, transcript variant E (Tao-1), mRNA 
0   NM_167665.1  CG14217-RD, transcript variant D (Tao-1), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   13  NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   11  NM_165056.1  CG31845-RA (CG31845), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.