National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7979R-1 
 Symbol CG7979  Full Name CG7979 
 CG No CG7979  Old CG No CG7979 
 Synonyms CG7979 
 Accession No (Link to NCBI) NM_139925.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGCCACCAAAAAGCGTCTG 
 Primer Seq. 3'
aatctagaggtaccATGAGCTCGAAGTTCTCGTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGCCACCA AAAAGCGTCT GAAGATCGTT GCAGCCATCT CGCTGCTCCT CCTGCTCCTG 
0061 GTCTACCTTT ACCGAATGGC CAGCTTCTGC CCAAGCGGAA AGGTCGCCGT TTCCGTTCCC 
0121 GGCGTCGAGG AGGTTCAGGC CAAATGGCGC CGCCCACGGA AAGTCCGCTA CAAAGGAGCC 
0181 TTCAGATGGC GTACGAGGAG CAGAGCTCTC TTATTCGAGA ACAAAAGGCC GAACTCCAGC 
0241 GCACAAGGGA GAATTTGGCC AGATTGGAGG AACAAGTTCG TAGCCTCCAG ACCAGCACAC 
0301 CGCGCAAGTA TCCGAAGGTT AAATACCTGA ACTATAAGAA TCGCAAACGC ATACTAATTA 
0361 CCGGAGGAGC TGGCTTCGTG GGCTCCCACT TGGTCGACGA TCTGATGGTC CAGGGGCACG 
0421 AGGTCATCGT GGTGGACAAT TTCTTTACGG GACGCAAGCG AAATGTCGAG CACTGGCTGG 
0481 GGCACGAGAA CTTCGAGCTC AT 
 in silico PCR Fragment
0001 ACTGCCACCA AAAAGCGTCT GAAGATCGTT GCAGCCATCT CGCTGCTCCT CCTGCTCCTG 
0061 GTCTACCTTT ACCGAATGGC CAGCTTCTGC CCAAGCGGAA AGGTCGCCGT TTCCGTTCCC 
0121 GGCGTCGAGG AGGTTCAGGC CAAATG--GC CGCCCACGGA AAGTCCGCTA CAAAGGAGCC 
0181 TTCAGATGGC GTACGAGGAG CAGAGCTCTC TTATTCGAGA ACAAAAGGCC GAACTCCAGC 
0241 GCACAAGGGA GAATTTGGCC AGATTGGAGG AACAAGTTCG TAGCCTCCAG ACCAGCACAC 
0301 CGCGCAAGTA TCCGAAGGTT AAATACCTGA ACTATAAGAA TCGCAAACGC ATACTAATTA 
0361 CCGGAGGAGC TGGCTTCGTG GGCTCCCACT TGGTCGACGA TCTGATGGTC CAGGGGCACG 
0421 AGGTCATCGT GGTGGACAAT TTCTTTACGG GACGCAAGCG AAATGTCGAG CACTGGCTGG 
0481 GGCACGAGAA CTTCGAGCTC AT 
 Assemble Data

7979R-1.IR_full       1   ACTGCCACCAAAAAGCGTCTGAAGATCGTTGCAGCCATCTCGCTGCTCCTCCTGCTCCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     1   ACTGCCACCAAAAAGCGTCTGAAGATCGTTGCAGCCATCTCGCTGCTCCTCCTGCTCCTG 60


7979R-1.IR_full       61  GTCTACCTTTACCGAATGGCCAGCTTCTGCCCAAGCGGAAAGGTCGCCGTTTCCGTTCCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     61  GTCTACCTTTACCGAATGGCCAGCTTCTGCCCAAGCGGAAAGGTCGCCGTTTCCGTTCCC 120


7979R-1.IR_full       121 GGCGTCGAGGAGGTTCAGGCCAAATGGCGCCGCCCACGGAAAGTCCGCTACAAAGGAGCC 180
                          ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||
7979R-1.in silico     121 GGCGTCGAGGAGGTTCAGGCCAAATG--GCCGCCCACGGAAAGTCCGCTACAAAGGAGCC 180


7979R-1.IR_full       181 TTCAGATGGCGTACGAGGAGCAGAGCTCTCTTATTCGAGAACAAAAGGCCGAACTCCAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     181 TTCAGATGGCGTACGAGGAGCAGAGCTCTCTTATTCGAGAACAAAAGGCCGAACTCCAGC 240


7979R-1.IR_full       241 GCACAAGGGAGAATTTGGCCAGATTGGAGGAACAAGTTCGTAGCCTCCAGACCAGCACAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     241 GCACAAGGGAGAATTTGGCCAGATTGGAGGAACAAGTTCGTAGCCTCCAGACCAGCACAC 300


7979R-1.IR_full       301 CGCGCAAGTATCCGAAGGTTAAATACCTGAACTATAAGAATCGCAAACGCATACTAATTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     301 CGCGCAAGTATCCGAAGGTTAAATACCTGAACTATAAGAATCGCAAACGCATACTAATTA 360


7979R-1.IR_full       361 CCGGAGGAGCTGGCTTCGTGGGCTCCCACTTGGTCGACGATCTGATGGTCCAGGGGCACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     361 CCGGAGGAGCTGGCTTCGTGGGCTCCCACTTGGTCGACGATCTGATGGTCCAGGGGCACG 420


7979R-1.IR_full       421 AGGTCATCGTGGTGGACAATTTCTTTACGGGACGCAAGCGAAATGTCGAGCACTGGCTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7979R-1.in silico     421 AGGTCATCGTGGTGGACAATTTCTTTACGGGACGCAAGCGAAATGTCGAGCACTGGCTGG 480


7979R-1.IR_full       481 GGCACGAGAACTTCGAGCTCAT 502
                          ||||||||||||||||||||||
7979R-1.in silico     481 GGCACGAGAACTTCGAGCTCAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139925.2  CG7979-RA (CG7979), mRNA 
0.2   NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0.2   NM_165053.1  CG31813-RA (CG31813), mRNA 
0   NM_167965.1  CG32296-RA (Mrtf), mRNA 
0   NM_168636.1  CG32150-RB, transcript variant B (CG32150), mRNA 
0   17  NM_132665.1  CG15753-RA (CG15753), mRNA 
0   NM_132350.1  CG15321-RA (CG15321), mRNA 
0   NM_138059.1  CG13575-RA (CG13575), mRNA 
0   NM_140962.1  CG13248-RA (CG13248), mRNA 
0   10  NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   10  NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_140022.1  CG5087-RA (CG5087), mRNA 
0   12  NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_057742.3  CG3269-RA (Rab2), mRNA 
0   NM_142033.1  CG14376-RA (CG14376), mRNA 
0   12  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   11  NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_137669.1  CG13443-RA (CG13443), mRNA 
0   14  NM_167188.1  CG32703-RA (CG32703), mRNA 
0   12  NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   10  NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   10  NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_166604.1  CG9812-RC, transcript variant C (CG9812), mRNA 
0   NM_167667.1  CG14217-RB, transcript variant B (Tao-1), mRNA 
0   NM_134475.2  CG14217-RA, transcript variant A (Tao-1), mRNA 
0   NM_167666.1  CG14217-RE, transcript variant E (Tao-1), mRNA 
0   NM_167665.1  CG14217-RD, transcript variant D (Tao-1), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   13  NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   11  NM_165056.1  CG31845-RA (CG31845), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.