National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7867R-2 
 Symbol nuf  Full Name nuclear fallout 
 CG No CG33991  Old CG No CG7867 
 Synonyms CG33991, CG7867, unnamed, D2, Cy3-23, CG32140, anon-D2, EP3077, CIP-D2, nuf, Nuf 
 Accession No (Link to NCBI) NM_001038922.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGCGGAAACAATGTCCGGCG 
 Primer Seq. 3'
aatctagaggtaccGTTGGAGCTACGGCCCGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGCGGAAAC AATGTCCGGC GACAGTAGTC CCACCCCCAG CAGTCCGCCA TCCAGTACAG 
0061 CAGGCGTTGC CAAATCTCAG TGTTCTTCCC TTTCGGATGG CGAATCCTTT GAGGGATATG 
0121 GCGAAAATGA GTATCCCACC CAACTTCGCG AAGCCCGCAG CTCCAATTCC AATGGGAGCC 
0181 ATAATATGAG CAATCATATT AACAATAATT CTAATATCAG CGTGGGCAAC AACAGTGGAC 
0241 ACAACCACAG TGGACACTCG AACGATGGAA ATAACAACCT AAATGGCAGC ACTGGCGTCG 
0301 AACTCGATTT GGCTCCACAC GTCGGCTCAT CAACACCTCA AGATGATGAC GAACTAAACA 
0361 TAATGCCCCG GGATAATTGG GCCAGGCGCA GTCTGCGACG AACTCCCACC AGTTCCGGCC 
0421 GCAGGCAAAT TAGTTCAAAT GCCTTAGCCA GCCAACTCTA TAGATCATCG AGCTTTAACT 
0481 CATCGGGcCG TAGCTCCAAC  
 in silico PCR Fragment
0001 TTGCGGAAAC AATGTCCGGC GACAGTAGTC CCACCCCCAG CAGTCCGCCA TCCAGTACAG 
0061 CAGGCGTTGC CAAATCTCAG TGTTCTTCCC TTTCGGATGG CGAATCCTTT GAGGGATATG 
0121 GCGAAAATGA GTATCCCACC CAACTTCGCG AAGCCCGCAG CTCCAATTCC AATGGGAGCC 
0181 ATAATATGAG CAATCATATT AACAATAATT CTAATATCAG CGTGGGCAAC AACAGTGGAC 
0241 ACAACCACAG TGGACACTCG AACGATGGAA ATAACAACCT AAATGGCAGC ACTGGCGTCG 
0301 AACTCGATTT GGCTCCACAC GTCGGCTCAT CAACACCTCA AGATGATGAC GAACTAAACA 
0361 TAATGCCCCG GGATAATTGG GCCAGGCGCA GTCTGCGACG AACTCCCACC AGTTCCGGCC 
0421 GCAGGCAAAT TAGTTCAAAT GCCTTAGCCA GCCAACTCTA TAGATCATCG AGCTTTAACT 
0481 CATCGGGCCG TAGCTCCAAC  
 Assemble Data

7867R-2.IR_full       1   TTGCGGAAACAATGTCCGGCGACAGTAGTCCCACCCCCAGCAGTCCGCCATCCAGTACAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     1   TTGCGGAAACAATGTCCGGCGACAGTAGTCCCACCCCCAGCAGTCCGCCATCCAGTACAG 60


7867R-2.IR_full       61  CAGGCGTTGCCAAATCTCAGTGTTCTTCCCTTTCGGATGGCGAATCCTTTGAGGGATATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     61  CAGGCGTTGCCAAATCTCAGTGTTCTTCCCTTTCGGATGGCGAATCCTTTGAGGGATATG 120


7867R-2.IR_full       121 GCGAAAATGAGTATCCCACCCAACTTCGCGAAGCCCGCAGCTCCAATTCCAATGGGAGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     121 GCGAAAATGAGTATCCCACCCAACTTCGCGAAGCCCGCAGCTCCAATTCCAATGGGAGCC 180


7867R-2.IR_full       181 ATAATATGAGCAATCATATTAACAATAATTCTAATATCAGCGTGGGCAACAACAGTGGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     181 ATAATATGAGCAATCATATTAACAATAATTCTAATATCAGCGTGGGCAACAACAGTGGAC 240


7867R-2.IR_full       241 ACAACCACAGTGGACACTCGAACGATGGAAATAACAACCTAAATGGCAGCACTGGCGTCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     241 ACAACCACAGTGGACACTCGAACGATGGAAATAACAACCTAAATGGCAGCACTGGCGTCG 300


7867R-2.IR_full       301 AACTCGATTTGGCTCCACACGTCGGCTCATCAACACCTCAAGATGATGACGAACTAAACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     301 AACTCGATTTGGCTCCACACGTCGGCTCATCAACACCTCAAGATGATGACGAACTAAACA 360


7867R-2.IR_full       361 TAATGCCCCGGGATAATTGGGCCAGGCGCAGTCTGCGACGAACTCCCACCAGTTCCGGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     361 TAATGCCCCGGGATAATTGGGCCAGGCGCAGTCTGCGACGAACTCCCACCAGTTCCGGCC 420


7867R-2.IR_full       421 GCAGGCAAATTAGTTCAAATGCCTTAGCCAGCCAACTCTATAGATCATCGAGCTTTAACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7867R-2.in silico     421 GCAGGCAAATTAGTTCAAATGCCTTAGCCAGCCAACTCTATAGATCATCGAGCTTTAACT 480


7867R-2.IR_full       481 CATCGGGCCGTAGCTCCAAC 500
                          ||||||||||||||||||||
7867R-2.in silico     481 CATCGGGCCGTAGCTCCAAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038920.1  CG33991-RC, transcript variant C (nuf), mRNA 
100   482  NM_001038922.1  CG33991-RA, transcript variant A (nuf), mRNA 
14.52   70  NM_001038918.1  CG33991-RB, transcript variant B (nuf), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_176450.1  CG33208-RA, transcript variant A (MICAL), mRNA 
0   NM_165340.1  CG9317-RB, transcript variant B (CG9317), mRNA 
0   NM_136208.2  CG9317-RA, transcript variant A (CG9317), mRNA 
0   NM_140317.2  CG14122-RA (CG14122), mRNA 
0   NM_166747.1  CG1674-RA, transcript variant A (CG1674), mRNA 
0   NM_143656.1  CG1674-RB, transcript variant B (CG1674), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_001038919.1  CG33991-RE, transcript variant E (nuf), mRNA 
0   NM_001038917.1  CG33991-RF, transcript variant F (nuf), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_133133.1  CG7990-RA, transcript variant A (CG7990), mRNA 
0   NM_140048.2  CG4080-RA (CG4080), mRNA 
0   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_079512.2  CG2899-RA (ksr), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_140411.1  CG17368-RA (CG17368), mRNA 
0   NM_176302.1  CG6282-RB, transcript variant B (CG6282), mRNA 
0   NM_139986.2  CG6282-RA, transcript variant A (CG6282), mRNA 
0   NM_143196.1  CG8968-RA (CG8968), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.