National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7823R-4 
 Symbol RhoGDI  Full Name RhoGDI 
 CG No CG7823  Old CG No CG7823 
 Synonyms CG7823, RhoGDI 
 Accession No (Link to NCBI) NM_140905.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGACGAAGCACCATCCCGA 
 Primer Seq. 3'
aatctagaggtaccCGCGGGAGAATGTGCCTGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAGACGAAG CACCATCCCG AGCACCACGA CGACGATGTC CACGATGCCA ACTACCAGGC 
0061 GCCGCCGGAG AAGACCATCG AGGAAATAAT GGCCGCCGAT CAGGAGGATG AGAGCTTGCG 
0121 GCGCTACAAG GAGGCGCTCC TGGGTGCCGC CCAGACCGAG AAAATTATTG TTGAACCCAA 
0181 TGATCCCCGA AAAGTTATTG TAAAGAAACT GGCCCTCGTT GTCGAAGGAC GCGACGACAT 
0241 GGAATTGGAT CTTACCGGTG ACCTTAGTCA GCTGAAAAAG CAGCTTTTTG TGATCAAAGA 
0301 AGGTGTTCAG TACAAGGTGC GCATTGATTT TATTGTGCAG CGTGAAATAG TCCATGGCCT 
0361 TAAGTATGTT CAAAAGACTT CTCGCTTGGG TGTTAATGTT GACAAGATGA AGCATATGGT 
0421 TGGCTCCTAT CCGCCGAAGA AGGAGATTCA GTTCTATTTG ACGCCCGCCG AGGAGGCACC 
0481 TTCAGGCACA TTNCNCCCGc G 
 in silico PCR Fragment
0001 AGAGACGAAG CACCATCCCG AGCACCACGA CGACGATGTC CACGATGCCA ACTACCAGGC 
0061 GCCGCCGGAG AAGACCATCG AGGAAATAAT GGCCGCCGAT CAGGAGGATG AGAGCTTGCG 
0121 GCGCTACAAG GAGGCGCTCC TGGGTGCCGC CCAGACCGAG AAAATTATTG TTGAACCCAA 
0181 TGATCCCCGA AAAGTTATTG TAAAGAAACT GGCCCTCGTT GTCGAAGGAC GCGACGACAT 
0241 GGAATTGGAT CTTACCGGTG ACCTTAGTCA GCTGAAAAAG CAGCTTTTTG TGATCAAAGA 
0301 AGGTGTTCAG TACAAGGTGC GCATTGATTT TATTGTGCAG CGTGAAATAG TCCATGGCCT 
0361 TAAGTATGTT CAAAAGACTT CTCGCTTGGG TGTTAATGTT GACAAGATGA AGCATATGGT 
0421 TGGCTCCTAT CCGCCGAAGA AGGAGATTCA GTTCTATTTG ACGCCCGCCG AGGAGGCACC 
0481 TTCAGGCACA TT-CTCCCGC G 
 Assemble Data

7823R-4.IR_full       1   AGAGACGAAGCACCATCCCGAGCACCACGACGACGATGTCCACGATGCCAACTACCAGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     1   AGAGACGAAGCACCATCCCGAGCACCACGACGACGATGTCCACGATGCCAACTACCAGGC 60


7823R-4.IR_full       61  GCCGCCGGAGAAGACCATCGAGGAAATAATGGCCGCCGATCAGGAGGATGAGAGCTTGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     61  GCCGCCGGAGAAGACCATCGAGGAAATAATGGCCGCCGATCAGGAGGATGAGAGCTTGCG 120


7823R-4.IR_full       121 GCGCTACAAGGAGGCGCTCCTGGGTGCCGCCCAGACCGAGAAAATTATTGTTGAACCCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     121 GCGCTACAAGGAGGCGCTCCTGGGTGCCGCCCAGACCGAGAAAATTATTGTTGAACCCAA 180


7823R-4.IR_full       181 TGATCCCCGAAAAGTTATTGTAAAGAAACTGGCCCTCGTTGTCGAAGGACGCGACGACAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     181 TGATCCCCGAAAAGTTATTGTAAAGAAACTGGCCCTCGTTGTCGAAGGACGCGACGACAT 240


7823R-4.IR_full       241 GGAATTGGATCTTACCGGTGACCTTAGTCAGCTGAAAAAGCAGCTTTTTGTGATCAAAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     241 GGAATTGGATCTTACCGGTGACCTTAGTCAGCTGAAAAAGCAGCTTTTTGTGATCAAAGA 300


7823R-4.IR_full       301 AGGTGTTCAGTACAAGGTGCGCATTGATTTTATTGTGCAGCGTGAAATAGTCCATGGCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     301 AGGTGTTCAGTACAAGGTGCGCATTGATTTTATTGTGCAGCGTGAAATAGTCCATGGCCT 360


7823R-4.IR_full       361 TAAGTATGTTCAAAAGACTTCTCGCTTGGGTGTTAATGTTGACAAGATGAAGCATATGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     361 TAAGTATGTTCAAAAGACTTCTCGCTTGGGTGTTAATGTTGACAAGATGAAGCATATGGT 420


7823R-4.IR_full       421 TGGCTCCTATCCGCCGAAGAAGGAGATTCAGTTCTATTTGACGCCCGCCGAGGAGGCACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7823R-4.in silico     421 TGGCTCCTATCCGCCGAAGAAGGAGATTCAGTTCTATTTGACGCCCGCCGAGGAGGCACC 480


7823R-4.IR_full       481 TTCAGGCACATTNCNCCCGCG 501
                          |||||||||||| | ||||||
7823R-4.in silico     481 TTCAGGCACATT-CTCCCGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140905.2  CG7823-RA (RhoGDI), mRNA 
0   20  NM_130678.2  CG14419-RA (CG14419), mRNA 
0   NM_167538.1  CG32572-RA (CG32572), mRNA 
0   NM_164965.1  CG4881-RB, transcript variant B (salr), mRNA 
0   NM_078824.2  CG4881-RA, transcript variant A (salr), mRNA 
0   NM_140171.2  CG32075-RA (CG32075), mRNA 
0   11  NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_140430.2  CG6603-RA, transcript variant A (Hsc70Cb), mRNA 
0   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_132059.2  CG4766-RA (CG4766), mRNA 
0   NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_132904.1  CG9903-RA (CG9903), mRNA 
0   NM_142984.1  CG6364-RA (CG6364), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   NM_139836.2  CG8610-RA (Cdc27), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_001042833.1  CG41480-RA (CG41480), mRNA 
0   NM_001015346.1  CG40084-PC.3 (CG40084), mRNA 
0   NM_001015347.1  CG40084-PD.3 (CG40084), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_167570.1  CG8465-RC, transcript variant C (l(1)G0222), mRNA 
0   NM_132993.2  CG8465-RA, transcript variant A (l(1)G0222), mRNA 
0   NM_167569.1  CG8465-RB, transcript variant B (l(1)G0222), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.