National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7823R-2 
 Symbol RhoGDI  Full Name RhoGDI 
 CG No CG7823  Old CG No CG7823 
 Synonyms CG7823, RhoGDI 
 Accession No (Link to NCBI) NM_140905.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGAGACGAAGCACCATCCCGAGCACCACGACGACGATGTCCACGATGCCAACTACCAGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCGCCGGAGAAGACCATCGAGGAAATAATGGCCGCCGATCAGGAGGATGAGAGCTTGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCGCTACAAGGAGGCGCTCCTGGGTGCCGCCCAGACCGAGAAAATTATTGTTGAACCCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGATCCCCGAAAAGTTATTGTAAAGAAACTGGCCCTCGTTGTCGAAGGACGCGACGACAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAATTGGATCTTACCGGTGACCTTAGTCAGCTGAAAAAGCAGCTTTTTGTGATCAAAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGGTGTTCAGTACAAGGTGCGCATTGATTTTATTGTGCAGCGTGAAATAGTCCATGGCCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TAAGTATGTTCAAAAGACTTCTCGCTTGGGTGTTAATGTTGACAAGATGAAGCATATGGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGCTCCTATCCGCCGAAGAAGGAGATTCAGTTCTATTTGACGCCCGCCGAGGAGGCACC 480

7823R-2.IR_full       481 TTCAGGCACATTNCNCCCGCG 501
                          |||||||||||| | |||||| silico     481 TTCAGGCACATT-CTCCCGCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140905.2  CG7823-RA (RhoGDI), mRNA 
0   20  NM_130678.2  CG14419-RA (CG14419), mRNA 
0   NM_167538.1  CG32572-RA (CG32572), mRNA 
0   NM_164965.1  CG4881-RB, transcript variant B (salr), mRNA 
0   NM_078824.2  CG4881-RA, transcript variant A (salr), mRNA 
0   NM_140171.2  CG32075-RA (CG32075), mRNA 
0   11  NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_140430.2  CG6603-RA, transcript variant A (Hsc70Cb), mRNA 
0   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_132059.2  CG4766-RA (CG4766), mRNA 
0   NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_132904.1  CG9903-RA (CG9903), mRNA 
0   NM_142984.1  CG6364-RA (CG6364), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   NM_139836.2  CG8610-RA (Cdc27), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_001042833.1  CG41480-RA (CG41480), mRNA 
0   NM_001015346.1  CG40084-PC.3 (CG40084), mRNA 
0   NM_001015347.1  CG40084-PD.3 (CG40084), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_167570.1  CG8465-RC, transcript variant C (l(1)G0222), mRNA 
0   NM_132993.2  CG8465-RA, transcript variant A (l(1)G0222), mRNA 
0   NM_167569.1  CG8465-RB, transcript variant B (l(1)G0222), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.