National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7770R-4 
 Symbol CG7770  Full Name CG7770 
 CG No CG7770  Old CG No CG7770 
 Synonyms BcDNA:GH28557, CG7770 
 Accession No (Link to NCBI) NM_140902.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACAAGAAGAGCGCAGCGT 
 Primer Seq. 3'
aatctagaggtaccCCGCCACCTGACACTGCTGTT 
 Predicted Fragment Size
363 
 IR fragment full Seq
0001 TGGACAAGAA GAGCGCNGcN TNGTACAAAA AGATGCAGGC CGAGATTGAG TCGTACCAGA 
0061 ACCTGCAAAA ATCCTGCTTG AAGATGGTGA AGCAGCGAGC AGTGCTCGAA AGCCAGCTGA 
0121 ACGAGAACAA GTGCGTCCTG GACGAGCTGA ATCTTCTGGG CCCCGACAAC AAGGTCTACA 
0181 AGCTCTTCGG GCCCGTTCTG GTCAAACAGG AGCTGGAGGA GTCGCGCCAG AATGTCGGAA 
0241 AGCGCATCGA GTACATCTCC AAGGAGCTGA AGAGCTCCAC CGACGCACTG GAGAACATGG 
0301 AGAAGGACAT GCTGAAGCAT CGGGAATCCG TGGCCAAGTA CCAACAGCAG TGTCAGGTGG 
0361 CGG 
 in silico PCR Fragment
0001 TGGACAAGAA GAGCGCAGCG TTGTACAAAA AGATGCAGGC CGAGATTGAG TCGTACCAGA 
0061 ACCTGCAAAA ATCCTGCTTG AAGATGGTGA AGCAGCGAGC AGTGCTCGAA AGCCAGCTGA 
0121 ACGAGAACAA GTGCGTCCTG GACGAGCTGA ATCTTCTGGG CCCCGACAAC AAGGTCTACA 
0181 AGCTCTTCGG GCCCGTTCTG GTCAAACAGG AGCTGGAGGA GTCGCGCCAG AATGTCGGAA 
0241 AGCGCATCGA GTACATCTCC AAGGAGCTGA AGAGCTCCAC CGACGCACTG GAGAACATGG 
0301 AGAAGGACAT GCTGAAGCAT CGGGAATCCG TGGCCAAGTA CCAACAGCAG TGTCAGGTGG 
0361 CGG 
 Assemble Data

7770R-4.IR_full       1   TGGACAAGAAGAGCGCNGCNTNGTACAAAAAGATGCAGGCCGAGATTGAGTCGTACCAGA 60
                          |||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     1   TGGACAAGAAGAGCGCAGCGTTGTACAAAAAGATGCAGGCCGAGATTGAGTCGTACCAGA 60


7770R-4.IR_full       61  ACCTGCAAAAATCCTGCTTGAAGATGGTGAAGCAGCGAGCAGTGCTCGAAAGCCAGCTGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     61  ACCTGCAAAAATCCTGCTTGAAGATGGTGAAGCAGCGAGCAGTGCTCGAAAGCCAGCTGA 120


7770R-4.IR_full       121 ACGAGAACAAGTGCGTCCTGGACGAGCTGAATCTTCTGGGCCCCGACAACAAGGTCTACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     121 ACGAGAACAAGTGCGTCCTGGACGAGCTGAATCTTCTGGGCCCCGACAACAAGGTCTACA 180


7770R-4.IR_full       181 AGCTCTTCGGGCCCGTTCTGGTCAAACAGGAGCTGGAGGAGTCGCGCCAGAATGTCGGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     181 AGCTCTTCGGGCCCGTTCTGGTCAAACAGGAGCTGGAGGAGTCGCGCCAGAATGTCGGAA 240


7770R-4.IR_full       241 AGCGCATCGAGTACATCTCCAAGGAGCTGAAGAGCTCCACCGACGCACTGGAGAACATGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     241 AGCGCATCGAGTACATCTCCAAGGAGCTGAAGAGCTCCACCGACGCACTGGAGAACATGG 300


7770R-4.IR_full       301 AGAAGGACATGCTGAAGCATCGGGAATCCGTGGCCAAGTACCAACAGCAGTGTCAGGTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7770R-4.in silico     301 AGAAGGACATGCTGAAGCATCGGGAATCCGTGGCCAAGTACCAACAGCAGTGTCAGGTGG 360


7770R-4.IR_full       361 CGG 363
                          |||
7770R-4.in silico     361 CGG 363

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   345  NM_140902.1  CG7770-RA (CG7770), mRNA 
0   NM_142949.3  CG5977-RB, transcript variant B (spas), mRNA 
0   NM_170115.2  CG5977-RA, transcript variant A (spas), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_166040.1  CG8479-RA, transcript variant A (CG8479), mRNA 
0   NM_137097.2  CG8479-RB, transcript variant B (CG8479), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_135436.1  CG17005-RA (CG17005), mRNA 
0   NM_138258.2  CG2211-RA (CG2211), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_134997.2  CG17840-RA (CG17840), mRNA 
0   NM_140733.2  CG6322-RA (CG6322), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   NM_140955.2  CG5649-RA (kin17), mRNA 
0   NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   NM_143086.2  CG13651-RA (danr), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 
0   NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.