National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7770R-3 
 Symbol CG7770  Full Name CG7770 
 CG No CG7770  Old CG No CG7770 
 Synonyms BcDNA:GH28557, CG7770 
 Accession No (Link to NCBI) NM_140902.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0361 CGG 
 in silico PCR Fragment
0361 CGG 
 Assemble Data

                          |||||||||||||||| || | |||||||||||||||||||||||||||||||||||||| silico     1   TGGACAAGAAGAGCGCAGCGTTGTACAAAAAGATGCAGGCCGAGATTGAGTCGTACCAGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCTGCAAAAATCCTGCTTGAAGATGGTGAAGCAGCGAGCAGTGCTCGAAAGCCAGCTGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACGAGAACAAGTGCGTCCTGGACGAGCTGAATCTTCTGGGCCCCGACAACAAGGTCTACA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCTCTTCGGGCCCGTTCTGGTCAAACAGGAGCTGGAGGAGTCGCGCCAGAATGTCGGAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCGCATCGAGTACATCTCCAAGGAGCTGAAGAGCTCCACCGACGCACTGGAGAACATGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGAAGGACATGCTGAAGCATCGGGAATCCGTGGCCAAGTACCAACAGCAGTGTCAGGTGG 360

7770R-3.IR_full       361 CGG 363
                          ||| silico     361 CGG 363

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   345  NM_140902.1  CG7770-RA (CG7770), mRNA 
0   NM_142949.3  CG5977-RB, transcript variant B (spas), mRNA 
0   NM_170115.2  CG5977-RA, transcript variant A (spas), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_166040.1  CG8479-RA, transcript variant A (CG8479), mRNA 
0   NM_137097.2  CG8479-RB, transcript variant B (CG8479), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_135436.1  CG17005-RA (CG17005), mRNA 
0   NM_138258.2  CG2211-RA (CG2211), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_134997.2  CG17840-RA (CG17840), mRNA 
0   NM_140733.2  CG6322-RA (CG6322), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   NM_140955.2  CG5649-RA (kin17), mRNA 
0   NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   NM_143086.2  CG13651-RA (danr), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 
0   NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.