National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7757R-3 
 Symbol CG7757  Full Name CG7757 
 CG No CG7757  Old CG No CG7757 
 Synonyms CG7757 
 Accession No (Link to NCBI) NM_140899.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGGATGGCGACGACCAGAA 
 Primer Seq. 3'
aatctagaggtaccCATCGTCCAGAATCAGGGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAGNATGGC GACGACCAGA AATTGTCCAA AAAGCGCGCT GCCgNCTCAG ATTCCAAAAG 
0061 TGGTGGTGGA AGCGCCCTTG AAGCgNCCAA GAAATCCCGC TTCGATGTCC CGGAAAAGAA 
0121 TGGCGGCGGT GGTGAGAAGA AAGAAGAGGT CGCCGTGCCC GCCTCGCTGA GTTCCACGCA 
0181 GATCAAGCTG ATGATGGCCC ATGCCCAGCG GGAGATCGAG GAACGCAAGC GGGCCCTGAG 
0241 TAATCTAAGA GACAAGGATC CGCTGCTGGC GTCAGTTCCA TCGATCGGAA TGCCCGTCGC 
0301 CTTAGCCACT CAAGCGCTGG CGAAGAAGCC CACGCCCGAG GACTCGGAGA AGGCCAGGAA 
0361 GATTGCCGAG TTGCAGGCGC AGATCAGGGC CAAGCTTACT GGCAATTTGG CTAGTTTGAT 
0421 TCAGCCCACT gCGGTANCNG NCGccGCTNC AGCTGNTGCT CAAGcGCAGG AGCGACCCAA 
0481 ACCCCTGATT CTGGACGATG  
 in silico PCR Fragment
0001 CAAGGATGGC GACGACCAGA AATTGTCCAA AAAGCGCGCT GCCGCCTCAG ATTCCAAAAG 
0061 TGGTGGTGGA AGCGCCCTTG AAGCGCCCAA GAAATCCCGC TTCGATGTCC CGGAAAAGAA 
0121 TGGCGGCGGT GGTGAGAAGA AAGAAGAGGT CGCCGTGCCC GCCTCGCTGA GTTCCACGCA 
0181 GATCAAGCTG ATGATGGCCC ATGCCCAGCG GGAGATCGAG GAACGCAAGC GGGCCCTGAG 
0241 TAATCTAAGA GACAAGGATC CGCTGCTGGC GTCAGTTCCA TCGATCGGAA TGCCAGTTGC 
0301 CTTAGCCACT CAAGCGCTGG CGAAGAAGCC CACGCCCGAG GACTCGGAGA AGGCCAGGAA 
0361 GATTGCCGAG TTGCAGGCAC AGATCAGGGC CAAGCTTACT GGCAATTTGG CTAGTTTGAT 
0421 TCAGCCCACT GCGGTAGCGG CCGCCGCTGC AGCTGCTGCT CAAGCGCAGG AGCGACCCAA 
0481 ACCCCTGATT CTGGACGATG  
 Assemble Data

7757R-3.IR_full       1   CAAGNATGGCGACGACCAGAAATTGTCCAAAAAGCGCGCTGCCGNCTCAGATTCCAAAAG 60
                          |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||
7757R-3.in silico     1   CAAGGATGGCGACGACCAGAAATTGTCCAAAAAGCGCGCTGCCGCCTCAGATTCCAAAAG 60


7757R-3.IR_full       61  TGGTGGTGGAAGCGCCCTTGAAGCGNCCAAGAAATCCCGCTTCGATGTCCCGGAAAAGAA 120
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
7757R-3.in silico     61  TGGTGGTGGAAGCGCCCTTGAAGCGCCCAAGAAATCCCGCTTCGATGTCCCGGAAAAGAA 120


7757R-3.IR_full       121 TGGCGGCGGTGGTGAGAAGAAAGAAGAGGTCGCCGTGCCCGCCTCGCTGAGTTCCACGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7757R-3.in silico     121 TGGCGGCGGTGGTGAGAAGAAAGAAGAGGTCGCCGTGCCCGCCTCGCTGAGTTCCACGCA 180


7757R-3.IR_full       181 GATCAAGCTGATGATGGCCCATGCCCAGCGGGAGATCGAGGAACGCAAGCGGGCCCTGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7757R-3.in silico     181 GATCAAGCTGATGATGGCCCATGCCCAGCGGGAGATCGAGGAACGCAAGCGGGCCCTGAG 240


7757R-3.IR_full       241 TAATCTAAGAGACAAGGATCCGCTGCTGGCGTCAGTTCCATCGATCGGAATGCCCGTCGC 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
7757R-3.in silico     241 TAATCTAAGAGACAAGGATCCGCTGCTGGCGTCAGTTCCATCGATCGGAATGCCAGTTGC 300


7757R-3.IR_full       301 CTTAGCCACTCAAGCGCTGGCGAAGAAGCCCACGCCCGAGGACTCGGAGAAGGCCAGGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7757R-3.in silico     301 CTTAGCCACTCAAGCGCTGGCGAAGAAGCCCACGCCCGAGGACTCGGAGAAGGCCAGGAA 360


7757R-3.IR_full       361 GATTGCCGAGTTGCAGGCGCAGATCAGGGCCAAGCTTACTGGCAATTTGGCTAGTTTGAT 420
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
7757R-3.in silico     361 GATTGCCGAGTTGCAGGCACAGATCAGGGCCAAGCTTACTGGCAATTTGGCTAGTTTGAT 420


7757R-3.IR_full       421 TCAGCCCACTGCGGTANCNGNCGCCGCTNCAGCTGNTGCTCAAGCGCAGGAGCGACCCAA 480
                          |||||||||||||||| | | ||||||| |||||| ||||||||||||||||||||||||
7757R-3.in silico     421 TCAGCCCACTGCGGTAGCGGCCGCCGCTGCAGCTGCTGCTCAAGCGCAGGAGCGACCCAA 480


7757R-3.IR_full       481 ACCCCTGATTCTGGACGATG 500
                          ||||||||||||||||||||
7757R-3.in silico     481 ACCCCTGATTCTGGACGATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140899.1  CG7757-RA, transcript variant A (CG7757), mRNA 
99.37   479  NM_168825.1  CG7757-RB, transcript variant B (CG7757), mRNA 
0.41   67  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.41   67  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.41   NM_143178.1  CG5886-RA (CG5886), mRNA 
0.2   10  NM_135207.2  CG11319-RA (CG11319), mRNA 
0   10  28  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0   16  NM_206365.1  CG11551-RA (ind), mRNA 
0   28  NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   28  NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   11  NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   16  61  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   16  58  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   12  35  NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   12  35  NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   12  35  NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   12  27  NM_169909.1  CG5460-RB, transcript variant B (H), mRNA 
0   12  27  NM_169908.1  CG5460-RD, transcript variant D (H), mRNA 
0   12  27  NM_169907.1  CG5460-RA, transcript variant A (H), mRNA 
0   12  27  NM_079694.2  CG5460-RC, transcript variant C (H), mRNA 
0   12  19  NM_078586.3  CG4070-RA, transcript variant A (Tis11), mRNA 
0   12  19  NM_167333.2  CG4070-RB, transcript variant B (Tis11), mRNA 
0   12  14  NM_001042816.1  CG9907-RC, transcript variant C (para), mRNA 
0   12  14  NM_001042815.1  CG9907-RB, transcript variant B (para), mRNA 
0   12  14  NM_078647.3  CG9907-RA, transcript variant A (para), mRNA 
0   11  49  NM_132172.2  CG15478-RA (CG15478), mRNA 
0   11  44  NM_001032019.1  CG3992-RD, transcript variant D (srp), mRNA 
0   11  22  NM_001014462.1  CG3151-RG, transcript variant G (Rbp9), mRNA 
0   11  21  NM_057589.2  CG3151-RA, transcript variant A (Rbp9), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.