National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7740R-3 
 Symbol prominin-like  Full Name prominin-like 
 CG No CG7740  Old CG No CG7740 
 Synonyms bs29e02.y1, CG7740, prominin-like 
 Accession No (Link to NCBI) NM_167986.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGACACTTTGAGCTTGGGTC 
 Primer Seq. 3'
aatctagaggtaccCAAGGAATTACTCTCCGATGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGACACTTT GAGCTTGGGT CCCAAAGTGG AGGAGAATGA CTGGCGGGAT CTATTGGCTC 
0061 ATTATTGGAT GGTTCTCATC TGGGTTGTTA TTCTCGTGGT GCTCATTATA GTCATACCGT 
0121 TCATTGCCGT TTGCTATTGC TGTTTCTGTT GCTGCCGACG ATGTCGACAG GGATGTCCTC 
0181 CGTGTACCAG TAAACAGGAT GCTCAGCGGC GCTTCTGTTG TGGCATCTGT CTGTTGATCC 
0241 TCATCATCGG ACTGATTTTT GGCATCATTA TCGCCTTTGT TACCAACAAA ATGATTGACA 
0301 GCGGCTTTGC CGAGNACTNT CCGAGACAAT GAANGCGCGG CAGCGAGGAC ACTTGCACTT 
0361 ATCTGAAGGA TGTAGCCGAT CACGTTCACC ATCTGATGAT GTACAACTAC GAGGAGATGG 
0421 AGACTCATGT GCTTGATCAA TTAACCCACG CTCACCGGCA CATATTTTTG GATCTCTCCG 
0481 ACACATCGGA GAGTAATTCC TTG 
 in silico PCR Fragment
0001 CGGACACTTT GAGCTTGGGT CCCAAAGTGG AGGAGAATGA CTGGCGGGAT CTATTGGCTC 
0061 ATTATTGGAT GGTTCTCATC TGGGTTGTTA TTCTCGTGGT GCTCATTATA GTCATACCGT 
0121 TCATTGCCGT TTGCTATTGC TGTTTCTGTT GCTGCCGACG ATGTCGACAG GGATGTCCTC 
0181 CGTGTACCAG TAAACAGGAT GCTCAGCGGC GCTTCTGTTG TGGCATCTGT CTGTTGATCC 
0241 TCATCATCGG ACTGATTTTT GGCATCATTA TCGCCTTTGT TACCAACAAA ATGATTGACA 
0301 GCGGCTTTGC CGAG-ACT-T CCGAGACAAT GAA-GCGCGG CAGCGAGGAC ACTTGCACTT 
0361 ATCTGAAGGA TGTAGCCGAT CACGTTCACC ATCTGATGAT GTACAACTAC GAGGAGATGG 
0421 AGACTCATGT GCTTGATCAA TTAACCCACG CTCACCGGCA CATATTTTTG GATCTCTCCG 
0481 ACACATCGGA GAGTAATTCC TTG 
 Assemble Data

7740R-3.IR_full       1   CGGACACTTTGAGCTTGGGTCCCAAAGTGGAGGAGAATGACTGGCGGGATCTATTGGCTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     1   CGGACACTTTGAGCTTGGGTCCCAAAGTGGAGGAGAATGACTGGCGGGATCTATTGGCTC 60


7740R-3.IR_full       61  ATTATTGGATGGTTCTCATCTGGGTTGTTATTCTCGTGGTGCTCATTATAGTCATACCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     61  ATTATTGGATGGTTCTCATCTGGGTTGTTATTCTCGTGGTGCTCATTATAGTCATACCGT 120


7740R-3.IR_full       121 TCATTGCCGTTTGCTATTGCTGTTTCTGTTGCTGCCGACGATGTCGACAGGGATGTCCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     121 TCATTGCCGTTTGCTATTGCTGTTTCTGTTGCTGCCGACGATGTCGACAGGGATGTCCTC 180


7740R-3.IR_full       181 CGTGTACCAGTAAACAGGATGCTCAGCGGCGCTTCTGTTGTGGCATCTGTCTGTTGATCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     181 CGTGTACCAGTAAACAGGATGCTCAGCGGCGCTTCTGTTGTGGCATCTGTCTGTTGATCC 240


7740R-3.IR_full       241 TCATCATCGGACTGATTTTTGGCATCATTATCGCCTTTGTTACCAACAAAATGATTGACA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     241 TCATCATCGGACTGATTTTTGGCATCATTATCGCCTTTGTTACCAACAAAATGATTGACA 300


7740R-3.IR_full       301 GCGGCTTTGCCGAGNACTNTCCGAGACAATGAANGCGCGGCAGCGAGGACACTTGCACTT 360
                          |||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||
7740R-3.in silico     301 GCGGCTTTGCCGAG-ACT-TCCGAGACAATGAA-GCGCGGCAGCGAGGACACTTGCACTT 360


7740R-3.IR_full       361 ATCTGAAGGATGTAGCCGATCACGTTCACCATCTGATGATGTACAACTACGAGGAGATGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     361 ATCTGAAGGATGTAGCCGATCACGTTCACCATCTGATGATGTACAACTACGAGGAGATGG 420


7740R-3.IR_full       421 AGACTCATGTGCTTGATCAATTAACCCACGCTCACCGGCACATATTTTTGGATCTCTCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7740R-3.in silico     421 AGACTCATGTGCTTGATCAATTAACCCACGCTCACCGGCACATATTTTTGGATCTCTCCG 480


7740R-3.IR_full       481 ACACATCGGAGAGTAATTCCTTG 503
                          |||||||||||||||||||||||
7740R-3.in silico     481 ACACATCGGAGAGTAATTCCTTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139513.2  CG7740-RC, transcript variant C (prominin-like), mRNA 
100   482  NM_167987.1  CG7740-RB, transcript variant B (prominin-like), mRNA 
100   482  NM_167986.1  CG7740-RA, transcript variant A (prominin-like), mRNA 
0   10  NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0   10  NM_206631.1  CG10706-RF, transcript variant F (SK), mRNA 
0   NM_167030.1  CG10706-RD, transcript variant D (SK), mRNA 
0   NM_080339.2  CG10706-RE, transcript variant E (SK), mRNA 
0   10  NM_140548.3  CG6169-RA, transcript variant A (CG6169), mRNA 
0   11  NM_139456.2  CG8985-RA (DmsR-1), mRNA 
0   17  NM_206058.1  CG30361-RC, transcript variant C (mXr), mRNA 
0   17  NM_165609.1  CG30361-RB, transcript variant B (mXr), mRNA 
0   17  NM_136542.1  CG30361-RA, transcript variant A (mXr), mRNA 
0   NM_142263.2  CG5013-RA (CG5013), mRNA 
0   NM_140735.1  CG6311-RB (CG6311), mRNA 
0   12  53  NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_140751.2  CG32190-RA (NUCB1), mRNA 
0   34  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   67  74  NM_132288.1  CG15365-RA (CG15365), mRNA 
0   15  53  NM_206089.1  CG33473-RB (luna), mRNA 
0   13  37  NM_078575.2  CG9355-RA (dy), mRNA 
0   11  26  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0   11  26  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0   35  NM_168239.1  CG17888-RC, transcript variant C (Pdp1), mRNA 
0   NM_165219.1  CG6667-RC, transcript variant C (dl), mRNA 
0   NM_078873.2  CG15162-RA (MESR3), mRNA 
0   NM_137662.1  CG11136-RA (CG11136), mRNA 
0   NM_057784.4  CG7833-RA (Orc5), mRNA 
0   NM_057773.3  CG7538-RA (Mcm2), mRNA 
0   22  52  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   22  52  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.