National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7707R-1 
 Symbol CG7707  Full Name CG7707 
 CG No CG7707  Old CG No CG7707 
 Synonyms CG7707 
 Accession No (Link to NCBI) NM_140705.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTGCAGGACTTGCCGGCTGA 
 Primer Seq. 3'
aatctagaggtaccCCTCCACGTTCCAGTGCCAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTGCAGGAC TTGCCGGCTG AGGTGCTGCA TATGGTCATG GGCCATTTGG ACCTATATCA 
0061 CCACAAGTTG CTGCGGGAAA CTTCGGAGGA ACTGAAGCAA ATCAGCACGG CGTACATATT 
0121 GCATCATCAC AAGGCCTACG AGGTGGCCCA NTTCGGAAGG AACCTCGGAG AAGGAGCAGA 
0181 GTAGCGCGAA AAGGATCATG CTGCAGGTCC TGCGCACGAC AATTAGCTAC TTTTCCGACG 
0241 AAGACAGTGA ATCCGACGTA GCCATCAGTC TGCTGCACTT CCACTCTAAG GAGGCTGTTT 
0301 TTTATAACGA AGCTGACCAN TCTGGGCAAG TTCCTTGCCC ATTNTCCTGT TCCTCAATGA 
0361 GCGAACGTTC AACGTATTCA GTGCTGAGAG ACTGAAACTT AAGCGCCTCC ATTACACAAT 
0421 GGCAATTTTC GGCCTATTGC GACAATTTCG AAATTTTAGA ATCCTGGGAT TCGGCAAGAC 
0481 CATTTGGCAC TGGAACGTGG AGG 
 in silico PCR Fragment
0001 ATTGCAGGAC TTGCCGGCTG AGGTGCTGCA TATGGTCATG GGCCATTTGG ACCTATATCA 
0061 CCACAAGTTG CTGCGGGAAA CTTCGGAGGA ACTGAAGCAA ATCAGCACGG CGTACATATT 
0121 GCATCATCAC AAGGCCTACG AGGTGGCCCA -TTCGGAAGG AACCTCGGAG AAGGAGCAGA 
0181 GTAGCGCGAA AAGGATCATG CTGCAGGTCC TGCGCACGAC AATTAGCTAC TTTTCCGACG 
0241 AAGACAGTGA ATCCGACGTA GCCATCAGTC TGCTGCACTT CCACTCTAAG GAGGCTGTTT 
0301 TTTATAACGA AGCTGACCA- TCTGGGCAAG TTCCTTGCCC ATT-TCCTGT TCCTCAATGA 
0361 GCGAACGTTC AACGTATTCA GTGCTGAGAG ACTGAAGCTT AAGCGCCTCC ATTACACAAT 
0421 GGCAATTTTC GGCCTATTGC GACAATTTCG AAATTTTAGA ATCCTGGGAT TCGGTAAGAC 
0481 CATTTGGCAC TGGAACGTGG AGG 
 Assemble Data

7707R-1.IR_full       1   ATTGCAGGACTTGCCGGCTGAGGTGCTGCATATGGTCATGGGCCATTTGGACCTATATCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7707R-1.in silico     1   ATTGCAGGACTTGCCGGCTGAGGTGCTGCATATGGTCATGGGCCATTTGGACCTATATCA 60


7707R-1.IR_full       61  CCACAAGTTGCTGCGGGAAACTTCGGAGGAACTGAAGCAAATCAGCACGGCGTACATATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7707R-1.in silico     61  CCACAAGTTGCTGCGGGAAACTTCGGAGGAACTGAAGCAAATCAGCACGGCGTACATATT 120


7707R-1.IR_full       121 GCATCATCACAAGGCCTACGAGGTGGCCCANTTCGGAAGGAACCTCGGAGAAGGAGCAGA 180
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
7707R-1.in silico     121 GCATCATCACAAGGCCTACGAGGTGGCCCA-TTCGGAAGGAACCTCGGAGAAGGAGCAGA 180


7707R-1.IR_full       181 GTAGCGCGAAAAGGATCATGCTGCAGGTCCTGCGCACGACAATTAGCTACTTTTCCGACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7707R-1.in silico     181 GTAGCGCGAAAAGGATCATGCTGCAGGTCCTGCGCACGACAATTAGCTACTTTTCCGACG 240


7707R-1.IR_full       241 AAGACAGTGAATCCGACGTAGCCATCAGTCTGCTGCACTTCCACTCTAAGGAGGCTGTTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7707R-1.in silico     241 AAGACAGTGAATCCGACGTAGCCATCAGTCTGCTGCACTTCCACTCTAAGGAGGCTGTTT 300


7707R-1.IR_full       301 TTTATAACGAAGCTGACCANTCTGGGCAAGTTCCTTGCCCATTNTCCTGTTCCTCAATGA 360
                          ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||
7707R-1.in silico     301 TTTATAACGAAGCTGACCA-TCTGGGCAAGTTCCTTGCCCATT-TCCTGTTCCTCAATGA 360


7707R-1.IR_full       361 GCGAACGTTCAACGTATTCAGTGCTGAGAGACTGAAACTTAAGCGCCTCCATTACACAAT 420
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
7707R-1.in silico     361 GCGAACGTTCAACGTATTCAGTGCTGAGAGACTGAAGCTTAAGCGCCTCCATTACACAAT 420


7707R-1.IR_full       421 GGCAATTTTCGGCCTATTGCGACAATTTCGAAATTTTAGAATCCTGGGATTCGGCAAGAC 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
7707R-1.in silico     421 GGCAATTTTCGGCCTATTGCGACAATTTCGAAATTTTAGAATCCTGGGATTCGGTAAGAC 480


7707R-1.IR_full       481 CATTTGGCACTGGAACGTGGAGG 503
                          |||||||||||||||||||||||
7707R-1.in silico     481 CATTTGGCACTGGAACGTGGAGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140705.2  CG7707-RA (CG7707), mRNA 
0   NM_001043010.1  CG9432-RD, transcript variant D (l(2)01289), mRNA 
0   NM_165485.1  CG9432-RB, transcript variant B (l(2)01289), mRNA 
0   NM_137090.1  CG18327-RA (CG18327), mRNA 
0   NM_135787.2  CG9414-RA (Rep4), mRNA 
0   NM_167020.1  CG6986-RB, transcript variant B (CG6986), mRNA 
0   NM_131955.1  CG6986-RA, transcript variant A (CG6986), mRNA 
0   NM_164890.1  CG4839-RB, transcript variant B (CG4839), mRNA 
0   NM_135505.2  CG4839-RA, transcript variant A (CG4839), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_132174.2  CG32721-RA (CG32721), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_164492.1  CG31690-RB, transcript variant B (CG31690), mRNA 
0   NM_205893.1  CG31690-RA, transcript variant A (CG31690), mRNA 
0   13  29  NM_139653.1  CG11350-RB (CG11350), mRNA 
0   12  NM_136862.1  CG8271-RA (CG8271), mRNA 
0   NM_079895.2  CG11064-RA (RfaBp), mRNA 
0   NM_139804.1  CG14821-RA (CG14821), mRNA 
0   NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
0   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0   NM_136707.2  CG1371-RA (CG1371), mRNA 
0   NM_141691.1  CG8500-RA (CG8500), mRNA 
0   NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   NM_135766.2  CG16974-RA (CG16974), mRNA 
0   NM_166910.1  CG14815-RA, transcript variant A (CG14815), mRNA 
0   NM_140762.1  CG5535-RA, transcript variant A (CG5535), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.