National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7671R-4 
 Symbol CG7671  Full Name CG7671 
 CG No CG7671  Old CG No CG7671 
 Synonyms CG7671 
 Accession No (Link to NCBI) NM_142459.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCATTGCAAACGTTTCCACGCACTACATATCCGAGAAGGTGTCCCAAGTGCGCTGGCTTC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGGAGGAACTGCAGCAGAGCGAACGGTTCGTTACTGGAAGCTGGGACATGGACCAGAACT 120

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCG-TGCGCCTCTGGCGGCTACAATCGAACCAATATGTCACCGCCACGGATTCGGAAGTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACCAGATACCTCGCTGCATGGACAAGGTGAGAATGGAGGACGATGTGACCGCCATGGAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCGTCGACAAGGACACGCTGGCTGTGAGCTGTGCCGATGGTCATCTCAGCGTGTTTAAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTCCATCGAGCCGTGGAGGAGGATCAGATGCAACGTACGTCCCGATCGGGACGTCTGCAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCTTCCAACGTAGCCAGGAGCCCGCTCCTTGCACCGACCTTTCTGTTTACGGCACGGAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCGCCACCGCCGGCGAGGATGGGTGTGTAAGCATCGTCTCCGTGGAAAATGTGCGCCAG 480

7671R-4.IR_full       481 GTGAAGCGACAGATTGAGGCG 501
                          ||||||||||||||||||||| silico     481 GTGAAGCGACAGATTGAGGCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142459.2  CG7671-RA (CG7671), mRNA 
0.41   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0.41   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_137517.4  CG18604-RA (CG18604), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_001014730.1  CG33557-RA (CG33557), mRNA 
0   NM_143535.1  CG15534-RA (CG15534), mRNA 
0   NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
0   NM_141736.1  CG11872-RA (CG11872), mRNA 
0   NM_165747.2  CG4001-RC, transcript variant C (Pfk), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 
0   NM_078952.2  CG4001-RA, transcript variant A (Pfk), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_134936.2  CG8843-RA (sec5), mRNA 
0   NM_206711.1  CG33249-RA (CG33249), mRNA 
0   NM_140202.1  CG6168-RB (CG6168), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_164790.1  CG31605-RG, transcript variant G (Bsg), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   10  15  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   10  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_140899.1  CG7757-RA, transcript variant A (CG7757), mRNA 
0   NM_134524.2  CG9570-RA (CG9570), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.