National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7671R-1 
 Symbol CG7671  Full Name CG7671 
 CG No CG7671  Old CG No CG7671 
 Synonyms CG7671 
 Accession No (Link to NCBI) NM_142459.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATTGCAAACGTTTCCACGC 
 Primer Seq. 3'
aatctagaggtaccCGCCTCAATCTGTCGCTTCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCATTGCAAA CGTTTCCACG CACTACATAT CCGAGAAGGT GTCCCAAGTG CGCTGGCTTC 
0061 CGGAGGAACT GCAGCAGAGC GAACGGTTCG TTACTGGAAG CTGGGACATG GACCAGAACT 
0121 TCGNTGCGCC TCTGGCGGCT ACAATCGAAC CAATATGTCA CCGCCACGGA TTCGGAAGTG 
0181 GACCAGATAC CTCGCTGCAT GGACAAGGTG AGAATGGAGG ACGATGTGAC CGCCATGGAG 
0241 TTCGTCGACA AGGACACGCT GGCTGTGAGC TGTGCCGATG GTCATCTCAG CGTGTTTAAC 
0301 GTCCATCGAG CCGTGGAGGA GGATCAGATG CAACGTACGT CCCGATCGGG ACGTCTGCAC 
0361 TGCTTCCAAC GTAGCCAGGA GCCCGCTCCT TGCACCGACC TTTCTGTTTA CGGCACGGAT 
0421 ATCGCCACCG CCGGCGAGGA TGGGTGTGTA AGCATCGTCT CCGTGGAAAA TGTGCGCCAG 
0481 GTGAAGCGAC AGATTGAGGC G 
 in silico PCR Fragment
0001 CCATTGCAAA CGTTTCCACG CACTACATAT CCGAGAAGGT GTCCCAAGTG CGCTGGCTTC 
0061 CGGAGGAACT GCAGCAGAGC GAACGGTTCG TTACTGGAAG CTGGGACATG GACCAGAACT 
0121 TCG-TGCGCC TCTGGCGGCT ACAATCGAAC CAATATGTCA CCGCCACGGA TTCGGAAGTG 
0181 GACCAGATAC CTCGCTGCAT GGACAAGGTG AGAATGGAGG ACGATGTGAC CGCCATGGAG 
0241 TTCGTCGACA AGGACACGCT GGCTGTGAGC TGTGCCGATG GTCATCTCAG CGTGTTTAAC 
0301 GTCCATCGAG CCGTGGAGGA GGATCAGATG CAACGTACGT CCCGATCGGG ACGTCTGCAC 
0361 TGCTTCCAAC GTAGCCAGGA GCCCGCTCCT TGCACCGACC TTTCTGTTTA CGGCACGGAT 
0421 ATCGCCACCG CCGGCGAGGA TGGGTGTGTA AGCATCGTCT CCGTGGAAAA TGTGCGCCAG 
0481 GTGAAGCGAC AGATTGAGGC G 
 Assemble Data

7671R-1.IR_full       1   CCATTGCAAACGTTTCCACGCACTACATATCCGAGAAGGTGTCCCAAGTGCGCTGGCTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     1   CCATTGCAAACGTTTCCACGCACTACATATCCGAGAAGGTGTCCCAAGTGCGCTGGCTTC 60


7671R-1.IR_full       61  CGGAGGAACTGCAGCAGAGCGAACGGTTCGTTACTGGAAGCTGGGACATGGACCAGAACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     61  CGGAGGAACTGCAGCAGAGCGAACGGTTCGTTACTGGAAGCTGGGACATGGACCAGAACT 120


7671R-1.IR_full       121 TCGNTGCGCCTCTGGCGGCTACAATCGAACCAATATGTCACCGCCACGGATTCGGAAGTG 180
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     121 TCG-TGCGCCTCTGGCGGCTACAATCGAACCAATATGTCACCGCCACGGATTCGGAAGTG 180


7671R-1.IR_full       181 GACCAGATACCTCGCTGCATGGACAAGGTGAGAATGGAGGACGATGTGACCGCCATGGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     181 GACCAGATACCTCGCTGCATGGACAAGGTGAGAATGGAGGACGATGTGACCGCCATGGAG 240


7671R-1.IR_full       241 TTCGTCGACAAGGACACGCTGGCTGTGAGCTGTGCCGATGGTCATCTCAGCGTGTTTAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     241 TTCGTCGACAAGGACACGCTGGCTGTGAGCTGTGCCGATGGTCATCTCAGCGTGTTTAAC 300


7671R-1.IR_full       301 GTCCATCGAGCCGTGGAGGAGGATCAGATGCAACGTACGTCCCGATCGGGACGTCTGCAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     301 GTCCATCGAGCCGTGGAGGAGGATCAGATGCAACGTACGTCCCGATCGGGACGTCTGCAC 360


7671R-1.IR_full       361 TGCTTCCAACGTAGCCAGGAGCCCGCTCCTTGCACCGACCTTTCTGTTTACGGCACGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     361 TGCTTCCAACGTAGCCAGGAGCCCGCTCCTTGCACCGACCTTTCTGTTTACGGCACGGAT 420


7671R-1.IR_full       421 ATCGCCACCGCCGGCGAGGATGGGTGTGTAAGCATCGTCTCCGTGGAAAATGTGCGCCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7671R-1.in silico     421 ATCGCCACCGCCGGCGAGGATGGGTGTGTAAGCATCGTCTCCGTGGAAAATGTGCGCCAG 480


7671R-1.IR_full       481 GTGAAGCGACAGATTGAGGCG 501
                          |||||||||||||||||||||
7671R-1.in silico     481 GTGAAGCGACAGATTGAGGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142459.2  CG7671-RA (CG7671), mRNA 
0.41   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0.41   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_137517.4  CG18604-RA (CG18604), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_001014730.1  CG33557-RA (CG33557), mRNA 
0   NM_143535.1  CG15534-RA (CG15534), mRNA 
0   NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
0   NM_141736.1  CG11872-RA (CG11872), mRNA 
0   NM_165747.2  CG4001-RC, transcript variant C (Pfk), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 
0   NM_078952.2  CG4001-RA, transcript variant A (Pfk), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_134936.2  CG8843-RA (sec5), mRNA 
0   NM_206711.1  CG33249-RA (CG33249), mRNA 
0   NM_140202.1  CG6168-RB (CG6168), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_164790.1  CG31605-RG, transcript variant G (Bsg), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   10  15  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   10  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_140899.1  CG7757-RA, transcript variant A (CG7757), mRNA 
0   NM_134524.2  CG9570-RA (CG9570), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.