National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7669R-2 
 Symbol CG7669  Full Name CG7669 
 CG No CG7669  Old CG No CG7669 
 Synonyms anon-WO0140519.198, CG7669 
 Accession No (Link to NCBI) NM_142457.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTTTCTTAGCGGCAACCCAC 
 Primer Seq. 3'
aatctagaggtaccTGGTAACTCCTTCTGGACCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTTTCTTAG CGGCAACCCA CACGCCCGTC GCTATTTGGG CGCCCGAGTG GTGTCCTACC 
0061 TGAGTTCCTC CTCTGACGAC GAAAGCCAAG TGGTCATCAC CAAGACGGTA GCCGAGGTAA 
0121 ATCAACTAAG TCTGCGAGTG GACACGCCTC CGGAGGATGA NGACGCCCTC GGTGCGCACT 
0181 CTGATGCCAG GCAGTGCCCA TTCTCGGGTT AAGGATGAGG ACGAGGCTGA AGACGAGGAT 
0241 GATGACGAAG GTGATGGCGA AAATGATAAC GATAATGAGG ACGAGAATGA TGACGAGGAT 
0301 GCTGAAGTCG AGGAAATCGA AGAAGAGGAG GAAGAAATTC CAGGAGACGA ANGACGACGC 
0361 CCAAAGCGAT GGATCCATGG GTCGTCAATC CGCCGACGAC AGCGACGAGG AGGAGGGCAC 
0421 GGATGTGGAA GTGGAGCAGC TGGAGGAGGA CGAACCAATT GTAACAGCTG TGTGCAAAAA 
0481 GACGGTCCAG AAGGAGTTAC CA 
 in silico PCR Fragment
0001 AGTTTCTTAG CGGCAACCCA CACGCCCGTC GCTATTTGGG CGCCCGAGTG GTGTCCTACC 
0061 TGAGTTCCTC CTCTGACGAC GAAAGCCAAG TGGTCATCAC CAAGACGGTA GCCGAGGTAA 
0121 ATCAACTAAG TCTGCGAGTG GACACGCCTC CGGAGGATGA -GACGCCCTC GGTGCGCACT 
0181 CTGATGCCAG GCAGTGCCCA TTCTCGGGTT AAGGATGAGG ACGAGGCTGA AGACGAGGAT 
0241 GATGACGAAG GTGATGGCGA AAATGATAAC GATAATGAGG ACGAGAATGA TGACGAGGAT 
0301 GCTGAAGTCG AGGAAATCGA AGAAGAGGAG GAAGAAATTC CAGGAGACGA A-GACGACGC 
0361 CCAAAGCGAT GGATCCATGG GTCGTCAATC CGCCGACGAC AGCGACGAGG AGGAGGGCAC 
0421 GGATGTGGAA GTGGAGCAGC TGGAGGAGGA CGAACCAATT GTAACAGCTG TGTGCAAAAA 
0481 GACGGTCCAG AAGGAGTTAC CA 
 Assemble Data

7669R-2.IR_full       1   AGTTTCTTAGCGGCAACCCACACGCCCGTCGCTATTTGGGCGCCCGAGTGGTGTCCTACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     1   AGTTTCTTAGCGGCAACCCACACGCCCGTCGCTATTTGGGCGCCCGAGTGGTGTCCTACC 60


7669R-2.IR_full       61  TGAGTTCCTCCTCTGACGACGAAAGCCAAGTGGTCATCACCAAGACGGTAGCCGAGGTAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     61  TGAGTTCCTCCTCTGACGACGAAAGCCAAGTGGTCATCACCAAGACGGTAGCCGAGGTAA 120


7669R-2.IR_full       121 ATCAACTAAGTCTGCGAGTGGACACGCCTCCGGAGGATGANGACGCCCTCGGTGCGCACT 180
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
7669R-2.in silico     121 ATCAACTAAGTCTGCGAGTGGACACGCCTCCGGAGGATGA-GACGCCCTCGGTGCGCACT 180


7669R-2.IR_full       181 CTGATGCCAGGCAGTGCCCATTCTCGGGTTAAGGATGAGGACGAGGCTGAAGACGAGGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     181 CTGATGCCAGGCAGTGCCCATTCTCGGGTTAAGGATGAGGACGAGGCTGAAGACGAGGAT 240


7669R-2.IR_full       241 GATGACGAAGGTGATGGCGAAAATGATAACGATAATGAGGACGAGAATGATGACGAGGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     241 GATGACGAAGGTGATGGCGAAAATGATAACGATAATGAGGACGAGAATGATGACGAGGAT 300


7669R-2.IR_full       301 GCTGAAGTCGAGGAAATCGAAGAAGAGGAGGAAGAAATTCCAGGAGACGAANGACGACGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
7669R-2.in silico     301 GCTGAAGTCGAGGAAATCGAAGAAGAGGAGGAAGAAATTCCAGGAGACGAA-GACGACGC 360


7669R-2.IR_full       361 CCAAAGCGATGGATCCATGGGTCGTCAATCCGCCGACGACAGCGACGAGGAGGAGGGCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     361 CCAAAGCGATGGATCCATGGGTCGTCAATCCGCCGACGACAGCGACGAGGAGGAGGGCAC 420


7669R-2.IR_full       421 GGATGTGGAAGTGGAGCAGCTGGAGGAGGACGAACCAATTGTAACAGCTGTGTGCAAAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7669R-2.in silico     421 GGATGTGGAAGTGGAGCAGCTGGAGGAGGACGAACCAATTGTAACAGCTGTGTGCAAAAA 480


7669R-2.IR_full       481 GACGGTCCAGAAGGAGTTACCA 502
                          ||||||||||||||||||||||
7669R-2.in silico     481 GACGGTCCAGAAGGAGTTACCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  63  NM_142457.2  CG7669-RA (CG7669), mRNA 
0.41   NM_143201.3  CG14543-RA (CG14543), mRNA 
0   15  22  NM_079569.3  CG9429-RA (Crc), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   22  71  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   11  41  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_141889.2  CG3169-RA (Spt3), mRNA 
0   NM_170368.1  CG31051-RA (CG31051), mRNA 
0   12  32  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   12  32  NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   12  32  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   12  32  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   15  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   12  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   18  NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
0   18  NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
0   15  NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
0   10  NM_166677.1  CG3541-RB, transcript variant B (pio), mRNA 
0   14  NM_130524.2  CG3658-RA (CDC45L), mRNA 
0   NM_130516.2  CG3704-RA (CG3704), mRNA 
0   NM_139816.1  CG8641-RA (CG8641), mRNA 
0   NM_133106.2  CG7288-RA (CG7288), mRNA 
0   NM_166330.1  CG15112-RC, transcript variant C (ena), mRNA 
0   NM_001014536.1  CG15112-RE, transcript variant E (ena), mRNA 
0   NM_166329.1  CG15112-RA, transcript variant A (ena), mRNA 
0   NM_001014537.1  CG15112-RD, transcript variant D (ena), mRNA 
0   NM_166331.1  CG15112-RB, transcript variant B (ena), mRNA 
0   23  65  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.