National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7669R-1 
 Symbol CG7669  Full Name CG7669 
 CG No CG7669  Old CG No CG7669 
 Synonyms anon-WO0140519.198, CG7669 
 Accession No (Link to NCBI) NM_142457.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGTTTCTTAGCGGCAACCCACACGCCCGTCGCTATTTGGGCGCCCGAGTGGTGTCCTACC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGAGTTCCTCCTCTGACGACGAAAGCCAAGTGGTCATCACCAAGACGGTAGCCGAGGTAA 120

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     121 ATCAACTAAGTCTGCGAGTGGACACGCCTCCGGAGGATGA-GACGCCCTCGGTGCGCACT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGATGCCAGGCAGTGCCCATTCTCGGGTTAAGGATGAGGACGAGGCTGAAGACGAGGAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATGACGAAGGTGATGGCGAAAATGATAACGATAATGAGGACGAGAATGATGACGAGGAT 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     301 GCTGAAGTCGAGGAAATCGAAGAAGAGGAGGAAGAAATTCCAGGAGACGAA-GACGACGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCAAAGCGATGGATCCATGGGTCGTCAATCCGCCGACGACAGCGACGAGGAGGAGGGCAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGATGTGGAAGTGGAGCAGCTGGAGGAGGACGAACCAATTGTAACAGCTGTGTGCAAAAA 480

7669R-1.IR_full       481 GACGGTCCAGAAGGAGTTACCA 502
                          |||||||||||||||||||||| silico     481 GACGGTCCAGAAGGAGTTACCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  63  NM_142457.2  CG7669-RA (CG7669), mRNA 
0.41   NM_143201.3  CG14543-RA (CG14543), mRNA 
0   15  22  NM_079569.3  CG9429-RA (Crc), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   22  71  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   11  41  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_141889.2  CG3169-RA (Spt3), mRNA 
0   NM_170368.1  CG31051-RA (CG31051), mRNA 
0   12  32  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   12  32  NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   12  32  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   12  32  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   15  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   12  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   18  NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
0   18  NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
0   15  NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
0   10  NM_166677.1  CG3541-RB, transcript variant B (pio), mRNA 
0   14  NM_130524.2  CG3658-RA (CDC45L), mRNA 
0   NM_130516.2  CG3704-RA (CG3704), mRNA 
0   NM_139816.1  CG8641-RA (CG8641), mRNA 
0   NM_133106.2  CG7288-RA (CG7288), mRNA 
0   NM_166330.1  CG15112-RC, transcript variant C (ena), mRNA 
0   NM_001014536.1  CG15112-RE, transcript variant E (ena), mRNA 
0   NM_166329.1  CG15112-RA, transcript variant A (ena), mRNA 
0   NM_001014537.1  CG15112-RD, transcript variant D (ena), mRNA 
0   NM_166331.1  CG15112-RB, transcript variant B (ena), mRNA 
0   23  65  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.