National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7644R-2 
 Symbol beat-Ib  Full Name beaten path Ib 
 CG No CG7644  Old CG No CG7644 
 Synonyms beat-B, beat Ib, CT23325, BG:DS00365.4, CG7644, BcDNA:RE51929, beat-Ib 
 Accession No (Link to NCBI) NM_078855.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTTTGCCAGGTCTCACTGTT 
 Primer Seq. 3'
aatctagaggtaccGGTGGCACCTGTATGTCATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTTTGCCAG GTCTCACTGT TGGGCTGCGG AACGTCAACG TTCGCATACC GTCCGCCGTT 
0061 AAGCGTGGCG ATAATGCGCT CTTAATCTGC AATTATGACA TCGAGAACGA CACGCTCTAC 
0121 ACGGTGAAAT GGTATCGTGG CAGACGGGAG TTCTACCGCT ATACGCCCAA GGAAAATCCG 
0181 GCCTGGAAGA TATTCACCAA AACGAACGAA ATCGATGTCG AGACTGCCCA ATCGAATGCC 
0241 AGCCACGTTC TTTTGCGAAA TGTTCCCACC TCAATATCGG GCAAATTTGC CTGCGAAGTG 
0301 TCCGCAGATG CACCCACCTT CGATACTTCC ATCGTGGCCG CCGACATGGA GGTGGTTGAA 
0361 TTGCCCACCC AACGACCCAT AATTACTGGC ATCCATTCAA GATACCGTCT GGGGGACGTT 
0421 ATAAATGGGA ACTGCTCATC GGATTACTCC AAGCCGGCTG CGAATCTCAC CTGGTGGATC 
0481 AATGACATAC AGGTGCCACC  
 in silico PCR Fragment
0001 AGTTTGCCAG GTCTCACTGT TGGGCTGCGG AACGTCAACG TTCGCATACC GTCCGCCGTT 
0061 AAGCGTGGCG ATAATGCGCT CTTAATCTGC AATTATGACA TCGAGAACGA CACGCTCTAC 
0121 ACGGTGAAAT GGTATCGTGG CAGACGGGAG TTCTACCGCT ATACGCCCAA GGAAAATCCG 
0181 GCCTGGAAGA TATTCACCAA AACGAACGAA ATCGATGTCG AGACTGCCCA ATCGAATGCC 
0241 AGCCACGTTC TTTTGCGAAA TGTTCCCACC TCAATATCGG GCAAATTTGC CTGCGAAGTG 
0301 TCCGCAGATG CACCCACCTT CGATACTTCC ATCGTGGCCG CCGACATGGA GGTGGTTGAA 
0361 TTGCCCACCC AACGACCCAT AATTACTGGC ATCCATTCAA GATACCGTCT GGGGGACGTT 
0421 ATAAATGGGA ACTGCTCATC GGATTACTCC AAGCCGGCTG CGAATCTCAC CTGGTGGATC 
0481 AATGACATAC AGGTGCCACC  
 Assemble Data

7644R-2.IR_full       1   AGTTTGCCAGGTCTCACTGTTGGGCTGCGGAACGTCAACGTTCGCATACCGTCCGCCGTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     1   AGTTTGCCAGGTCTCACTGTTGGGCTGCGGAACGTCAACGTTCGCATACCGTCCGCCGTT 60


7644R-2.IR_full       61  AAGCGTGGCGATAATGCGCTCTTAATCTGCAATTATGACATCGAGAACGACACGCTCTAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     61  AAGCGTGGCGATAATGCGCTCTTAATCTGCAATTATGACATCGAGAACGACACGCTCTAC 120


7644R-2.IR_full       121 ACGGTGAAATGGTATCGTGGCAGACGGGAGTTCTACCGCTATACGCCCAAGGAAAATCCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     121 ACGGTGAAATGGTATCGTGGCAGACGGGAGTTCTACCGCTATACGCCCAAGGAAAATCCG 180


7644R-2.IR_full       181 GCCTGGAAGATATTCACCAAAACGAACGAAATCGATGTCGAGACTGCCCAATCGAATGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     181 GCCTGGAAGATATTCACCAAAACGAACGAAATCGATGTCGAGACTGCCCAATCGAATGCC 240


7644R-2.IR_full       241 AGCCACGTTCTTTTGCGAAATGTTCCCACCTCAATATCGGGCAAATTTGCCTGCGAAGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     241 AGCCACGTTCTTTTGCGAAATGTTCCCACCTCAATATCGGGCAAATTTGCCTGCGAAGTG 300


7644R-2.IR_full       301 TCCGCAGATGCACCCACCTTCGATACTTCCATCGTGGCCGCCGACATGGAGGTGGTTGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     301 TCCGCAGATGCACCCACCTTCGATACTTCCATCGTGGCCGCCGACATGGAGGTGGTTGAA 360


7644R-2.IR_full       361 TTGCCCACCCAACGACCCATAATTACTGGCATCCATTCAAGATACCGTCTGGGGGACGTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     361 TTGCCCACCCAACGACCCATAATTACTGGCATCCATTCAAGATACCGTCTGGGGGACGTT 420


7644R-2.IR_full       421 ATAAATGGGAACTGCTCATCGGATTACTCCAAGCCGGCTGCGAATCTCACCTGGTGGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7644R-2.in silico     421 ATAAATGGGAACTGCTCATCGGATTACTCCAAGCCGGCTGCGAATCTCACCTGGTGGATC 480


7644R-2.IR_full       481 AATGACATACAGGTGCCACC 500
                          ||||||||||||||||||||
7644R-2.in silico     481 AATGACATACAGGTGCCACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078855.2  CG7644-RA (beat-Ib), mRNA 
0   10  15  19  NM_078856.2  CG4838-RA (beat-Ic), mRNA 
0   15  NM_079660.3  CG14334-RA (beat-IIa), mRNA 
0   NM_079072.2  CG12501-RA (Or56a), mRNA 
0   NM_166523.1  CG5819-RB, transcript variant B (CG5819), mRNA 
0   NM_137816.1  CG5819-RA, transcript variant A (CG5819), mRNA 
0   NM_168753.1  CG5535-RB, transcript variant B (CG5535), mRNA 
0   NM_140762.1  CG5535-RA, transcript variant A (CG5535), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_167435.2  CG6146-RB, transcript variant B (Top1), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_132245.1  CG1387-RA (CG1387), mRNA 
0   NM_168601.1  CG3297-RC, transcript variant C (mnd), mRNA 
0   NM_168600.1  CG3297-RB, transcript variant B (mnd), mRNA 
0   NM_079350.4  CG3297-RA, transcript variant A (mnd), mRNA 
0   NM_165975.1  CG4712-RA, transcript variant A (CG4712), mRNA 
0   NM_137012.1  CG4712-RB, transcript variant B (CG4712), mRNA 
0   NM_141312.2  CG1245-RA (MED27), mRNA 
0   NM_142629.2  CG4335-RA (CG4335), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_170450.1  CG31036-RA (CG31036), mRNA 
0   NM_080004.2  CG31036-RA (CG31036), mRNA, ankyrin repeat, tyrosine kinase CG18247-RA (shark), mRNA 
0   11  NM_135986.2  CG15138-RB, transcript variant B (beat-IIIc), mRNA 
0   11  NM_165209.1  CG15138-RA, transcript variant A (beat-IIIc), mRNA 
0   11  NM_058160.3  CG4846-RA (beat-Ia), mRNA 
0   NM_176057.1  CG33179-RA (beat-IIIb), mRNA 
0   NM_132056.3  CG4790-RA (fs(1)M3), mRNA 
0   NM_057753.3  CG3283-RA (SdhB), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_138264.1  CG9173-RA (CG9173), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.