National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7623R-3 
 Symbol sll  Full Name slalom 
 CG No CG7623  Old CG No CG7623 
 Synonyms CG7623, 1422/14, l(3)S142214, anon-WO0172774.85, anon-WO0118547.555, sll 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACTTCTTCTCGGATCTGCT 
 Primer Seq. 3'
aatctagaggtaccGACGATTGGAAAACACCAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

7623R-3.IR full       1   ACACTTCTTCTCGGATCTGCTGAGAGCCTCCCTAGGCGGCTACTACAACCAGGATGTTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     1   ACACTTCTTCTCGGATCTGCTGAGAGCCTCCCTAGGCGGCTACTACAACCAGGATGTTAC 60


7623R-3.IR full       61  ACTTTCCCAGCTGGTTGAGTCGCAGAACTCGGACTACGCATGGTTCCTTAAGCTGCTGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     61  ACTTTCCCAGCTGGTTGAGTCGCAGAACTCGGACTACGCATGGTTCCTTAAGCTGCTGGT 120


7623R-3.IR full       121 CAATTGCTTTGGTTATAGCTGCGTCTTTGTGCCGGGCTTCTTGATCTACAAATATGTCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     121 CAATTGCTTTGGTTATAGCTGCGTCTTTGTGCCGGGCTTCTTGATCTACAAATATGTCGG 180


7623R-3.IR full       181 CAGGATTAACTACCTGGAAAGAGGCAACAAGACATTCCTGCACAAGGCTATCAATATGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     181 CAGGATTAACTACCTGGAAAGAGGCAACAAGACATTCCTGCACAAGGCTATCAATATGTG 240


7623R-3.IR full       241 TATCACGGGTAACTCTGGATACGATCAGTTGGATGCAGGGACCAGCGCCGCGGATAAGGA 300
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7623R-3.in silico     241 TATCACGGGTAACTCTGGATACGATCAGTTGGATGCAGGGACCAGCACCGCGGATAAGGA 300


7623R-3.IR full       301 TCGTCCGGCAGCCTCTACGGCACCAAAGCGTACGAGTTCCCAGGAGGCCGTGCAACTATT 360
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
7623R-3.in silico     301 TCGTCCGGCAGCCTCTACGGCACCAAAGCGAACGAGTTCCCAGGAGGCCGTGCAACTATT 360


7623R-3.IR full       361 ATGGTGCTTTGGCGGCCTGATGATCTCCTATCTTACCTGGGGTGTACTGCAGGAGAAGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     361 ATGGTGCTTTGGCGGCCTGATGATCTCCTATCTTACCTGGGGTGTACTGCAGGAGAAGAT 420


7623R-3.IR full       421 AATGACTCAAAACTATCTGAACTTCACTGGAGAAAGTGCCAAGTTTAAGGACTCTCAGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-3.in silico     421 AATGACTCAAAACTATCTGAACTTCACTGGAGAAAGTGCCAAGTTTAAGGACTCTCAGTT 480


7623R-3.IR full       481 CCTGGTGTTTTCCAATCGTC 500
                          ||||||||||||||||||||
7623R-3.in silico     481 CCTGGTGTTTTCCAATCGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079665.2  slalom CG7623-RA (sll), mRNA 
NM_135151.2  CG9175-RA, transcript variant A (CG9175), mRNA 
NM_164681.1  CG9175-RB, transcript variant B (CG9175), mRNA 
NM_142445.1  CG7146-RA (CG7146), mRNA 
NM_130501.3  CG5273-RA, transcript variant A (CG5273), mRNA 
NM_166863.1  CG5273-RC, transcript variant C (CG5273), mRNA 
NM_166862.1  CG5273-RB, transcript variant B (CG5273), mRNA 
NM_142691.1  CG5798-RA (CG5798), mRNA 
NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
NM_206356.2  Trithorax-like CG33261-RB, transcript variant B (Trl), mRNA 
NM_001038926.1  Trithorax-like CG33261-RI, transcript variant I (Trl), mRNA 
NM_134916.3  CG9663-RA (CG9663), mRNA 
NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
NM_141538.1  CG7352-RA (CG7352), mRNA 
NM_079614.2  snake CG7996-RA (snk), mRNA 
NM_134700.2  CG3561-RA (CG3561), mRNA 
NM_140401.1  CG10741-RB, transcript variant B (CG10741), mRNA 
NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
NM_140631.1  CG4729-RA, transcript variant A (CG4729), mRNA 
14  NM_167399.4  mushroom body defect CG12047-RB, transcript variant B (mud), mRNA 
14  NM_167400.3  mushroom body defect CG12047-RA, transcript variant A (mud), mRNA 
12  NM_080495.3  mushroom body defect CG12047-RC, transcript variant C (mud), mRNA 
NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 
NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
NM_176752.1  Glutathione Synthetase CG6835-RC, transcript variant C (GS), mRNA 
NM_176753.1  Glutathione Synthetase CG6835-RD, transcript variant D (GS), mRNA 
NM_143450.1  Odorant-binding protein 99a CG18111-RA (Obp99a), mRNA 
NM_142709.2  SIFamide receptor CG10823-RA, transcript variant A (SIFR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.