National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7623R-1 
 Symbol sll  Full Name slalom 
 CG No CG7623  Old CG No CG7623 
 Synonyms CG7623, 1422/14, l(3)S142214, anon-WO0172774.85, anon-WO0118547.555, sll 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACTTCTTCTCGGATCTGCT 
 Primer Seq. 3'
aatctagaggtaccGACGATTGGAAAACACCAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACACTTCTTC TCGGATCTGC TGAGAGCCTC CCTAGGCGGC TACTACAACC AGGATGTTAC 
0061 ACTTTCCCAG CTGGTTGAGT CGCAGAACTC GGACTACGCA TGGTTCCTTA AGCTGCTGGT 
0121 CAATTGCTTT GGTTATAGCT GCGTCTTTGT GCCGGGCTTC TTGATCTACA AATATGTCGG 
0181 CAGGATTAAC TACCTGGAAA GAGGCAACAA GACATTCCTG CACAAGGCTA TCAATATGTG 
0241 TATCACGGGT AACTCTGGAT ACGATCAGTT GGATGCAGGG ACCAGCGCCG CGGATAAGGA 
0301 TCGTCCGGCA GCCTCTACGG CACCAAAGCG TACGAGTTCC CAGGAGGCCG TGCAACTATT 
0361 ATGGTGCTTT GGCGGCCTGA TGATCTCCTA TCTTACCTGG GGTGTACTGC AGGAGAAGAT 
0421 AATGACTCAA AACTATCTGA ACTTCACTGG AGAAAGTGCC AAGTTTAAGG ACTCTCAGTT 
0481 CCTGGTGTTT TCCAATCGTC  
 in silico PCR Fragment
0001 acacttcttc tcggatctgc tgagagcctc cctaggcggc tactacaacc aggatgttac 
0061 actttcccag ctggttgagt cgcagaactc ggactacgca tggttcctta agctgctggt 
0121 caattgcttt ggttatagct gcgtctttgt gccgggcttc ttgatctaca aatatgtcgg 
0181 caggattaac tacctggaaa gaggcaacaa gacattcctg cacaaggcta tcaatatgtg 
0241 tatcacgggt aactctggat acgatcagtt ggatgcaggg accagcaccg cggataagga 
0301 tcgtccggca gcctctacgg caccaaagcg aacgagttcc caggaggccg tgcaactatt 
0361 atggtgcttt ggcggcctga tgatctccta tcttacctgg ggtgtactgc aggagaagat 
0421 aatgactcaa aactatctga acttcactgg agaaagtgcc aagtttaagg actctcagtt 
0481 cctggtgttt tccaatcgtc  
 Assemble Data

7623R-1.IR full       1   ACACTTCTTCTCGGATCTGCTGAGAGCCTCCCTAGGCGGCTACTACAACCAGGATGTTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     1   ACACTTCTTCTCGGATCTGCTGAGAGCCTCCCTAGGCGGCTACTACAACCAGGATGTTAC 60


7623R-1.IR full       61  ACTTTCCCAGCTGGTTGAGTCGCAGAACTCGGACTACGCATGGTTCCTTAAGCTGCTGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     61  ACTTTCCCAGCTGGTTGAGTCGCAGAACTCGGACTACGCATGGTTCCTTAAGCTGCTGGT 120


7623R-1.IR full       121 CAATTGCTTTGGTTATAGCTGCGTCTTTGTGCCGGGCTTCTTGATCTACAAATATGTCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     121 CAATTGCTTTGGTTATAGCTGCGTCTTTGTGCCGGGCTTCTTGATCTACAAATATGTCGG 180


7623R-1.IR full       181 CAGGATTAACTACCTGGAAAGAGGCAACAAGACATTCCTGCACAAGGCTATCAATATGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     181 CAGGATTAACTACCTGGAAAGAGGCAACAAGACATTCCTGCACAAGGCTATCAATATGTG 240


7623R-1.IR full       241 TATCACGGGTAACTCTGGATACGATCAGTTGGATGCAGGGACCAGCGCCGCGGATAAGGA 300
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
7623R-1.in silico     241 TATCACGGGTAACTCTGGATACGATCAGTTGGATGCAGGGACCAGCACCGCGGATAAGGA 300


7623R-1.IR full       301 TCGTCCGGCAGCCTCTACGGCACCAAAGCGTACGAGTTCCCAGGAGGCCGTGCAACTATT 360
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
7623R-1.in silico     301 TCGTCCGGCAGCCTCTACGGCACCAAAGCGAACGAGTTCCCAGGAGGCCGTGCAACTATT 360


7623R-1.IR full       361 ATGGTGCTTTGGCGGCCTGATGATCTCCTATCTTACCTGGGGTGTACTGCAGGAGAAGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     361 ATGGTGCTTTGGCGGCCTGATGATCTCCTATCTTACCTGGGGTGTACTGCAGGAGAAGAT 420


7623R-1.IR full       421 AATGACTCAAAACTATCTGAACTTCACTGGAGAAAGTGCCAAGTTTAAGGACTCTCAGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7623R-1.in silico     421 AATGACTCAAAACTATCTGAACTTCACTGGAGAAAGTGCCAAGTTTAAGGACTCTCAGTT 480


7623R-1.IR full       481 CCTGGTGTTTTCCAATCGTC 500
                          ||||||||||||||||||||
7623R-1.in silico     481 CCTGGTGTTTTCCAATCGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079665.2  slalom CG7623-RA (sll), mRNA 
NM_135151.2  CG9175-RA, transcript variant A (CG9175), mRNA 
NM_164681.1  CG9175-RB, transcript variant B (CG9175), mRNA 
NM_142445.1  CG7146-RA (CG7146), mRNA 
NM_130501.3  CG5273-RA, transcript variant A (CG5273), mRNA 
NM_166863.1  CG5273-RC, transcript variant C (CG5273), mRNA 
NM_166862.1  CG5273-RB, transcript variant B (CG5273), mRNA 
NM_142691.1  CG5798-RA (CG5798), mRNA 
NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
NM_206356.2  Trithorax-like CG33261-RB, transcript variant B (Trl), mRNA 
NM_001038926.1  Trithorax-like CG33261-RI, transcript variant I (Trl), mRNA 
NM_134916.3  CG9663-RA (CG9663), mRNA 
NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
NM_141538.1  CG7352-RA (CG7352), mRNA 
NM_079614.2  snake CG7996-RA (snk), mRNA 
NM_134700.2  CG3561-RA (CG3561), mRNA 
NM_140401.1  CG10741-RB, transcript variant B (CG10741), mRNA 
NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
NM_140631.1  CG4729-RA, transcript variant A (CG4729), mRNA 
14  NM_167399.4  mushroom body defect CG12047-RB, transcript variant B (mud), mRNA 
14  NM_167400.3  mushroom body defect CG12047-RA, transcript variant A (mud), mRNA 
12  NM_080495.3  mushroom body defect CG12047-RC, transcript variant C (mud), mRNA 
NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 
NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
NM_176752.1  Glutathione Synthetase CG6835-RC, transcript variant C (GS), mRNA 
NM_176753.1  Glutathione Synthetase CG6835-RD, transcript variant D (GS), mRNA 
NM_143450.1  Odorant-binding protein 99a CG18111-RA (Obp99a), mRNA 
NM_142709.2  SIFamide receptor CG10823-RA, transcript variant A (SIFR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.