National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7574R-2 
 Symbol bip1  Full Name bip1 
 CG No CG7574  Old CG No CG7574 
 Synonyms bip-I, CG7574, anon-WO0118547.246, bip1 
 Accession No (Link to NCBI) NM_139912.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mondal BC, Shim J, Evans CJ, Banerjee U.
Pvr expression regulators in equilibrium signal control and maintenance of Drosophila blood progenitors.
Elife (2014) 3 e03626 [ PubMed ID = 25201876 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCACTCTTCGGATTTGCCAG 
 Primer Seq. 3'
aatctagaggtaccATGGGCATAATGCCGGTGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCACTCTTC GGATTTGCCA GGCTGTGTCA GCTAAATCCT AGCGCGAATG GGCCGGAACC 
0061 AGTATTGCCA CCTTCCTCCA GGATTTGTCT GATGGGTTGC CAGGATGTAA AGCCCAATGA 
0121 TCTGCGTCGT TTTCCAGTCC ACGATACCGA TCGCTGCAAT CATTGGCTGC GTCACTTTGG 
0181 CGTCAGCTAT ANACTGGTGG ATCAACTCGG CGGCCTCCAA AAACTGGCGC ATCTGCTCCA 
0241 GACACTTTAG CCAACGCCAG GAGATGGCCA AAACCCGCAT CAAGATGACG CcgCTGCGCA 
0301 AGTCCTCGTC CTCCAAGGGC ATTGTGCTAC CCATTAATGN CGCTGGAGGG TCGGTCATTG 
0361 CAGGCGCCTT AGCAGGAGGA GGAGGTGCAG GAACTGGGAG CGGTGCTGTC AAGTCGGCGG 
0421 TGGCCAGCAG CACCACCATT GAACTTGTTG AGAGCCCCAA TAGACATCAG GCCAAGAAGC 
0481 CCAACACCGG CATTATGCCC AT 
 in silico PCR Fragment
0001 ACCACTCTTC GGATTTGCCA GGCTGTGTC- GCTAAATCCT AGCGCGAATG GGCCGGAACC 
0061 AGTATTGCCA CCTTCCTCCA GGATTTGTCT GATGGGTTGC CAGGATGTAA AGCCCAATGA 
0121 TCTGCGTCGT TTTCCAGTCC ACGATACCGA TCGCTGCAAT CATTGGCTGC GTCACTTTGG 
0181 CGTCAGCTAT AAACTGGTGG ATCAACTCGG CGGCCTCCAA AAGCT-GCGC ATCTGCTCCA 
0241 GACACTTTAG CCAACGCCAG GAGATGGCCA AAACCCGCAT CAAGATGACG CCGCTGCGCA 
0301 AGTCCTCGTC CTCCAAGGGC ATTGTGCTAC CCATTAATGC CGCTGGAGGG TCGGTCATTG 
0361 CAGGCGCCTT AGCAGGAGGA GGAGGTGCAG GAACTGGGAG CGGTGCTGTC AAGTCGGCGG 
0421 TGGCCAGCAG CACCACCATT GAACTTGTTG AGAGCCCCAA TAGACATCAG GCCAAGAAGC 
0481 CCAACACCGG CATTATGCCC AT 
 Assemble Data

7574R-2.IR_full       1   ACCACTCTTCGGATTTGCCAGGCTGTGTCAGCTAAATCCTAGCGCGAATGGGCCGGAACC 60
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
7574R-2.in silico     1   ACCACTCTTCGGATTTGCCAGGCTGTGTC-GCTAAATCCTAGCGCGAATGGGCCGGAACC 60


7574R-2.IR_full       61  AGTATTGCCACCTTCCTCCAGGATTTGTCTGATGGGTTGCCAGGATGTAAAGCCCAATGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7574R-2.in silico     61  AGTATTGCCACCTTCCTCCAGGATTTGTCTGATGGGTTGCCAGGATGTAAAGCCCAATGA 120


7574R-2.IR_full       121 TCTGCGTCGTTTTCCAGTCCACGATACCGATCGCTGCAATCATTGGCTGCGTCACTTTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7574R-2.in silico     121 TCTGCGTCGTTTTCCAGTCCACGATACCGATCGCTGCAATCATTGGCTGCGTCACTTTGG 180


7574R-2.IR_full       181 CGTCAGCTATANACTGGTGGATCAACTCGGCGGCCTCCAAAAACTGGCGCATCTGCTCCA 240
                          ||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||
7574R-2.in silico     181 CGTCAGCTATAAACTGGTGGATCAACTCGGCGGCCTCCAAAAGCT-GCGCATCTGCTCCA 240


7574R-2.IR_full       241 GACACTTTAGCCAACGCCAGGAGATGGCCAAAACCCGCATCAAGATGACGCCGCTGCGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7574R-2.in silico     241 GACACTTTAGCCAACGCCAGGAGATGGCCAAAACCCGCATCAAGATGACGCCGCTGCGCA 300


7574R-2.IR_full       301 AGTCCTCGTCCTCCAAGGGCATTGTGCTACCCATTAATGNCGCTGGAGGGTCGGTCATTG 360
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
7574R-2.in silico     301 AGTCCTCGTCCTCCAAGGGCATTGTGCTACCCATTAATGCCGCTGGAGGGTCGGTCATTG 360


7574R-2.IR_full       361 CAGGCGCCTTAGCAGGAGGAGGAGGTGCAGGAACTGGGAGCGGTGCTGTCAAGTCGGCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7574R-2.in silico     361 CAGGCGCCTTAGCAGGAGGAGGAGGTGCAGGAACTGGGAGCGGTGCTGTCAAGTCGGCGG 420


7574R-2.IR_full       421 TGGCCAGCAGCACCACCATTGAACTTGTTGAGAGCCCCAATAGACATCAGGCCAAGAAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7574R-2.in silico     421 TGGCCAGCAGCACCACCATTGAACTTGTTGAGAGCCCCAATAGACATCAGGCCAAGAAGC 480


7574R-2.IR_full       481 CCAACACCGGCATTATGCCCAT 502
                          ||||||||||||||||||||||
7574R-2.in silico     481 CCAACACCGGCATTATGCCCAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139912.3  CG7574-RA (bip1), mRNA 
0   NM_142620.1  CG15684-RA (CG15684), mRNA 
0   NM_137123.2  CG17390-RA (CG17390), mRNA 
0   NM_134983.2  CG4104-RA (Tps1), mRNA 
0   NM_145192.2  CG15107-RA (CG15107), mRNA 
0   NM_138073.1  CG13579-RA (CG13579), mRNA 
0   NM_136700.2  CG1407-RB, transcript variant B (CG1407), mRNA 
0   NM_165728.2  CG1407-RA, transcript variant A (CG1407), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   NM_080707.2  CG3430-RA (CG3430), mRNA 
0   NM_079711.2  CG6545-RA (lbe), mRNA 
0   NM_139676.1  CG13708-RA (CG13708), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_169351.1  CG4067-RC, transcript variant C (pug), mRNA 
0   NM_057906.3  CG4067-RA, transcript variant A (pug), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_080359.3  CG11822-RA, transcript variant A (nAcRbeta-21C), mRNA 
0   NM_164386.2  CG11822-RB, transcript variant B (nAcRbeta-21C), mRNA 
0   NM_132735.2  CG12540-RA (CG12540), mRNA 
0   NM_165628.1  CG30352-RA (CG30352), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_137871.2  CG3536-RA (CG3536), mRNA 
0   NM_166551.2  CG30267-RA (CG30267), mRNA 
0   26  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   26  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   22  NM_132012.1  CG15776-RA (CG15776), mRNA 
0   16  NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   16  NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.