National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7574R-1 
 Symbol bip1  Full Name bip1 
 CG No CG7574  Old CG No CG7574 
 Synonyms bip-I, CG7574, anon-WO0118547.246, bip1 
 Accession No (Link to NCBI) NM_139912.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     1   ACCACTCTTCGGATTTGCCAGGCTGTGTC-GCTAAATCCTAGCGCGAATGGGCCGGAACC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGTATTGCCACCTTCCTCCAGGATTTGTCTGATGGGTTGCCAGGATGTAAAGCCCAATGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTGCGTCGTTTTCCAGTCCACGATACCGATCGCTGCAATCATTGGCTGCGTCACTTTGG 180

                          ||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||| silico     181 CGTCAGCTATAAACTGGTGGATCAACTCGGCGGCCTCCAAAAGCT-GCGCATCTGCTCCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GACACTTTAGCCAACGCCAGGAGATGGCCAAAACCCGCATCAAGATGACGCCGCTGCGCA 300

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     301 AGTCCTCGTCCTCCAAGGGCATTGTGCTACCCATTAATGCCGCTGGAGGGTCGGTCATTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAGGCGCCTTAGCAGGAGGAGGAGGTGCAGGAACTGGGAGCGGTGCTGTCAAGTCGGCGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGCCAGCAGCACCACCATTGAACTTGTTGAGAGCCCCAATAGACATCAGGCCAAGAAGC 480

7574R-1.IR_full       481 CCAACACCGGCATTATGCCCAT 502
                          |||||||||||||||||||||| silico     481 CCAACACCGGCATTATGCCCAT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139912.3  CG7574-RA (bip1), mRNA 
0   NM_142620.1  CG15684-RA (CG15684), mRNA 
0   NM_137123.2  CG17390-RA (CG17390), mRNA 
0   NM_134983.2  CG4104-RA (Tps1), mRNA 
0   NM_145192.2  CG15107-RA (CG15107), mRNA 
0   NM_138073.1  CG13579-RA (CG13579), mRNA 
0   NM_136700.2  CG1407-RB, transcript variant B (CG1407), mRNA 
0   NM_165728.2  CG1407-RA, transcript variant A (CG1407), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   NM_080707.2  CG3430-RA (CG3430), mRNA 
0   NM_079711.2  CG6545-RA (lbe), mRNA 
0   NM_139676.1  CG13708-RA (CG13708), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_169351.1  CG4067-RC, transcript variant C (pug), mRNA 
0   NM_057906.3  CG4067-RA, transcript variant A (pug), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_080359.3  CG11822-RA, transcript variant A (nAcRbeta-21C), mRNA 
0   NM_164386.2  CG11822-RB, transcript variant B (nAcRbeta-21C), mRNA 
0   NM_132735.2  CG12540-RA (CG12540), mRNA 
0   NM_165628.1  CG30352-RA (CG30352), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_137871.2  CG3536-RA (CG3536), mRNA 
0   NM_166551.2  CG30267-RA (CG30267), mRNA 
0   26  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   26  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   22  NM_132012.1  CG15776-RA (CG15776), mRNA 
0   16  NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   16  NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.