National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7565R-2 
 Symbol CG7565  Full Name CG7565 
 CG No CG7565  Old CG No CG7565 
 Synonyms CT23145, CG7565 
 Accession No (Link to NCBI) NM_139914.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAACACAAGGAGACCAGCCC 
 Primer Seq. 3'
aatctagaggtaccCCTGATTGCGAGCCAGGTAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAAACACAAG GAGACCAGCC CCGATAATTC AGTTGGCGGT TCTATATCGC CCAATTTGGT 
0061 GTGCCACAAN GATGCTGAGG CATGTGTTCG AAAACGCCAC TCCGCGGGAT GAGCAGCAGG 
0121 CGGGTGTGTT TGAGGAGTAC AAGCCACCGC CGGATGCAGT GGAGCCACTG GAGGAGGAGG 
0181 CCTATCTTTG GAACTGCCTA CAGGCTTGCT GCGAAAAGCC CCGGAATGGC AGCAGTGCCT 
0241 GCAATGTGGT CCTCGTTTTT AAGGCCAAAT GCTACCATAT CCGATGCCAG AGCAACGAGG 
0301 CCTGCTTGCC CAAGCTCAGA GTTCGGATGC CCAACGAAAA GGTGCAAATG GTACTGGTCA 
0361 ATCCACTGGG CGATGcCACA TGGCCACAGC TCCTCAAGGC GGAGGCAGCC AAACAGAATG 
0421 CTGAGATTCT GCCATACGAT GAAGCGGCAC TTAATTTCTG GAAGCAGCCC AGAAGGTTGA 
0481 GCTACCTGGC TCGCAATCAG G 
 in silico PCR Fragment
0001 GAAACACAAG GAGACCAGCC CCGATAATTC AGTTGGCGGT TCTATATCGC CCAATTTGGT 
0061 GTGCCACAA- GATGCTGAGG CATGTGTTCG AAAACGCCAC TCCGCGGGAT GAGCAGCAGG 
0121 CGGGTGTGTT TGAGGAGTAC AAGCCACCGC CGGATGCAGT GGAGCCACTG GAGGAGGAGG 
0181 CCTATCTTTG GAACTGCCTA CAGGCTTGCT GCGAAAAGCC CCGGAATGGC AGCAGTGCCT 
0241 GCAATGTGGT CCTCGTTTTT AAGGCCAAAT GCTACCATAT CCGATGCCAG AGCAACGAGG 
0301 CCTGCTTGCC CAAGCTCAGA GTTCGGATGC CCAACGAAAA GGTTCAGATG GTACTGGTCA 
0361 ATCCACTGGG CGATGCCACA TGGCCACAGC TCCTCAAGGC GGAGGCAGCC AAACAGAATG 
0421 CTGAGATTCT GCCATACGAT GAAGCGGCAC TTAATTTCTG GAAGCAGCCC AGAAGGTTGA 
0481 GCTACCTGGC TCGCAATCAG G 
 Assemble Data

7565R-2.IR_full        1   AAACACAAGGAGACCAGCCCCGATAATTCAGTTGGCGGTTCTATATCGCCCAATTTGGT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico      1   AAACACAAGGAGACCAGCCCCGATAATTCAGTTGGCGGTTCTATATCGCCCAATTTGGT 59


7565R-2.IR_full       61  GTGCCACAANGATGCTGAGGCATGTGTTCGAAAACGCCACTCCGCGGGATGAGCAGCAGG 119
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     61  GTGCCACAA-GATGCTGAGGCATGTGTTCGAAAACGCCACTCCGCGGGATGAGCAGCAGG 119


7565R-2.IR_full       121 CGGGTGTGTTTGAGGAGTACAAGCCACCGCCGGATGCAGTGGAGCCACTGGAGGAGGAGG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     121 CGGGTGTGTTTGAGGAGTACAAGCCACCGCCGGATGCAGTGGAGCCACTGGAGGAGGAGG 179


7565R-2.IR_full       181 CCTATCTTTGGAACTGCCTACAGGCTTGCTGCGAAAAGCCCCGGAATGGCAGCAGTGCCT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     181 CCTATCTTTGGAACTGCCTACAGGCTTGCTGCGAAAAGCCCCGGAATGGCAGCAGTGCCT 239


7565R-2.IR_full       241 GCAATGTGGTCCTCGTTTTTAAGGCCAAATGCTACCATATCCGATGCCAGAGCAACGAGG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     241 GCAATGTGGTCCTCGTTTTTAAGGCCAAATGCTACCATATCCGATGCCAGAGCAACGAGG 299


7565R-2.IR_full       301 CCTGCTTGCCCAAGCTCAGAGTTCGGATGCCCAACGAAAAGGTGCAAATGGTACTGGTCA 359
                          ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||
7565R-2.in silico     301 CCTGCTTGCCCAAGCTCAGAGTTCGGATGCCCAACGAAAAGGTTCAGATGGTACTGGTCA 359


7565R-2.IR_full       361 ATCCACTGGGCGATGCCACATGGCCACAGCTCCTCAAGGCGGAGGCAGCCAAACAGAATG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     361 ATCCACTGGGCGATGCCACATGGCCACAGCTCCTCAAGGCGGAGGCAGCCAAACAGAATG 419


7565R-2.IR_full       421 CTGAGATTCTGCCATACGATGAAGCGGCACTTAATTTCTGGAAGCAGCCCAGAAGGTTGA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7565R-2.in silico     421 CTGAGATTCTGCCATACGATGAAGCGGCACTTAATTTCTGGAAGCAGCCCAGAAGGTTGA 479


7565R-2.IR_full       481 GCTACCTGGCTCGCAATCAGG 500
                          |||||||||||||||||||||
7565R-2.in silico     481 GCTACCTGGCTCGCAATCAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139914.2  CG7565-RA (CG7565), mRNA 
0   NM_206238.1  CG13923-RA (CG13923), mRNA 
0   NM_143496.3  CG15523-RA (CG15523), mRNA 
0   NM_001031882.1  CG4523-RD, transcript variant D (Pink1), mRNA 
0   NM_167083.2  CG4523-RB, transcript variant B (Pink1), mRNA 
0   NM_132112.3  CG4523-RA, transcript variant A (Pink1), mRNA 
0   NM_001031883.1  CG4523-RC, transcript variant C (Pink1), mRNA 
0   NM_001031881.1  CG4523-RE, transcript variant E (Pink1), mRNA 
0   NM_001031880.1  CG4523-RF, transcript variant F (Pink1), mRNA 
0   NM_001031879.1  CG4523-RG, transcript variant G (Pink1), mRNA 
0   NM_001031878.1  CG4523-RH, transcript variant H (Pink1), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_132423.1  CG11556-RA (Rph), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   NM_078610.2  CG11678-RA (Actr13E), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_142121.1  CG7886-RA (CG7886), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_079898.2  CG11081-RA, transcript variant A (plexA), mRNA 
0   NM_166804.2  CG11081-RB, transcript variant B (plexA), mRNA 
0   NM_166805.2  CG11081-RC, transcript variant C (plexA), mRNA 
0   NM_166806.2  CG11081-RD, transcript variant D (plexA), mRNA 
0   11  13  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   11  13  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   16  NM_078529.3  CG18009-RD, transcript variant D (Trf2), mRNA 
0   11  NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_136574.2  CG8258-RA (CG8258), mRNA 
0   NM_176144.1  CG33144-RA (CG33144), mRNA 
0   NM_136155.2  CG10628-RA (CG10628), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.