National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7554R-2 
 Symbol comm2  Full Name comm2 
 CG No CG7554  Old CG No CG7554 
 Synonyms CG7554, comm2 
 Accession No (Link to NCBI) NM_140544.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCACCCTGATCCTCATCTCG 
 Primer Seq. 3'
aatctagaggtaccGCTGCCAATGTTGCAGATGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCACCCTGA TCCTCATCTC GATGGTCTTC TGCATCTGCT CCTGCTTCCT GTACCATCAG 
0061 TTCCGCACCT GGAAACGCAA TTATCGCAAC AATGCAAATG GCTCGACGCA GTGCACCATT 
0121 GTAGATATAG AGGCGTTGAA ACTGCATCCG GATGTGGAGG ATCCGGTTCC GGAATACACC 
0181 CTAGTATCTG GATTGCCCAG CTACGAGGCG GCTCTGGAGC TGCTACAAAA ATCCCCGCAG 
0241 TCATCCTGCC TGATTGTCTA TCCGAGTGTG TTCAATGTGT TCAATAAGCA GGAGAGGAGC 
0301 AGCCAGGAGC TGNAGCATCC AGGAGTTGCA ACATCAGCAC CTCCAGCCGC ACCCGAGAAT 
0361 CACCTGGCAC CGCAGACACC TTCGTTTTGT GATGCCACAA TGCCGCTGCT CCCAGCAACA 
0421 ACAGCAGCAG CAGCAACACA TGCAGCAGCA ACAGTAACAG CAGTAACAGC AGCAACAGCA 
0481 ACATCTGCAA CANTTGGCAg C 
 in silico PCR Fragment
0001 TTCACCCTGA TCCTCATCTC GATGGTCTTC TGCATCTGCT CCTGCTTCCT GTACCATCAG 
0061 TTCCGCACCT GGAAACGCAA TTATCGCAAC AATGCAAATG GCTCGACGCA GTGCACCATT 
0121 GTAGATATAG AGGCGTTGAA ACTGCATCCG GATGTGGAGG ATCCGGTTCC GGAATACACC 
0181 CTAGTATCTG GATTGCCCAG CTACGAGGCG GCTCTGGAGC TGCTACAAAA ATCCCCGCAG 
0241 TCATCCTGCC TGATTGTCTA TCCGAGTGTG TTCAATGTGT TCAATAAGCA GGAGAGGAGC 
0301 AGCCAGGAGC TGCAGCATCC AGGAGTTGCA ACATCAGCAC CTCCAGCCGC ACCCGAGAAT 
0361 CACCTGGCAC CGCAGACACC TTCGTTTTGT GATGCCACAA TGCCGCTGCT CCCAGCAACA 
0421 ACAGCAGCAG CAGCAACACA TGCAGCAGCA ACAGTAACAG CAGTAACAGC AGCAACAGCA 
0481 ACATCTGCAA CA-TTGGCAG C 
 Assemble Data

7554R-2.IR_full       1   TTCACCCTGATCCTCATCTCGATGGTCTTCTGCATCTGCTCCTGCTTCCTGTACCATCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     1   TTCACCCTGATCCTCATCTCGATGGTCTTCTGCATCTGCTCCTGCTTCCTGTACCATCAG 60


7554R-2.IR_full       61  TTCCGCACCTGGAAACGCAATTATCGCAACAATGCAAATGGCTCGACGCAGTGCACCATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     61  TTCCGCACCTGGAAACGCAATTATCGCAACAATGCAAATGGCTCGACGCAGTGCACCATT 120


7554R-2.IR_full       121 GTAGATATAGAGGCGTTGAAACTGCATCCGGATGTGGAGGATCCGGTTCCGGAATACACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     121 GTAGATATAGAGGCGTTGAAACTGCATCCGGATGTGGAGGATCCGGTTCCGGAATACACC 180


7554R-2.IR_full       181 CTAGTATCTGGATTGCCCAGCTACGAGGCGGCTCTGGAGCTGCTACAAAAATCCCCGCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     181 CTAGTATCTGGATTGCCCAGCTACGAGGCGGCTCTGGAGCTGCTACAAAAATCCCCGCAG 240


7554R-2.IR_full       241 TCATCCTGCCTGATTGTCTATCCGAGTGTGTTCAATGTGTTCAATAAGCAGGAGAGGAGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     241 TCATCCTGCCTGATTGTCTATCCGAGTGTGTTCAATGTGTTCAATAAGCAGGAGAGGAGC 300


7554R-2.IR_full       301 AGCCAGGAGCTGNAGCATCCAGGAGTTGCAACATCAGCACCTCCAGCCGCACCCGAGAAT 360
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     301 AGCCAGGAGCTGCAGCATCCAGGAGTTGCAACATCAGCACCTCCAGCCGCACCCGAGAAT 360


7554R-2.IR_full       361 CACCTGGCACCGCAGACACCTTCGTTTTGTGATGCCACAATGCCGCTGCTCCCAGCAACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     361 CACCTGGCACCGCAGACACCTTCGTTTTGTGATGCCACAATGCCGCTGCTCCCAGCAACA 420


7554R-2.IR_full       421 ACAGCAGCAGCAGCAACACATGCAGCAGCAACAGTAACAGCAGTAACAGCAGCAACAGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7554R-2.in silico     421 ACAGCAGCAGCAGCAACACATGCAGCAGCAACAGTAACAGCAGTAACAGCAGCAACAGCA 480


7554R-2.IR_full       481 ACATCTGCAACANTTGGCAGC 501
                          |||||||||||| ||||||||
7554R-2.in silico     481 ACATCTGCAACA-TTGGCAGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  26  104  NM_140544.1  CG7554-RA (comm2), mRNA 
5.18   25  264  1045  2596  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
5.18   25  264  1045  2596  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
5.18   25  264  1045  2596  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
4.35   21  40  167  544  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
4.14   20  50  168  451  NM_166992.2  CG2904-RA (ec), mRNA 
4.14   20  48  158  556  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
4.14   20  44  136  468  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
4.14   20  44  135  466  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
3.94   19  64  220  610  NM_167000.1  CG32778-RA (CG32778), mRNA 
3.52   17  57  198  570  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
3.52   17  57  198  570  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
3.52   17  57  198  570  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
3.52   17  54  141  557  NM_168179.1  CG32394-RA (CG32394), mRNA 
3.52   17  43  205  606  NM_132246.2  CG10555-RA (CG10555), mRNA 
3.11   15  47  118  452  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
2.9   14  98  394  1136  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.9   14  98  394  1136  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
2.9   14  61  267  815  NM_078797.2  CG13109-RA (tai), mRNA 
2.9   14  32  159  502  NM_078592.2  CG11172-RA (NFAT), mRNA 
2.9   14  12  68  185  NM_166667.1  CG3411-RA (bs), mRNA 
2.69   13  90  324  1017  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.69   13  86  278  880  NM_135077.2  CG14023-RA (CG14023), mRNA 
2.69   13  70  195  565  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
2.69   13  70  195  565  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
2.69   13  37  111  347  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
2.69   13  34  110  480  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
2.69   13  34  110  480  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
2.48   12  18  84  313  NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
2.48   12  18  84  313  NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.