National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7529R-3 
 Symbol CG7529  Full Name CG7529 
 CG No CG7529  Old CG No CG7529 
 Synonyms CG7529 
 Accession No (Link to NCBI) NM_141064.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTGGGATGTTCTGGCTGTGA 
 Primer Seq. 3'
aatctagaggtaccAAACTGGCGTGGACCGTTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTGGGATGT TCTGGCTGTG AGCAACACGA TCAGCTTGTG AAGTGTATTC AAAAAGCGAA 
0061 AGTTATAGAC ATTNCTAAAG GCCACGGCCT CAGAATCCTT TTCGCCGATT GTTGGAGACC 
0121 TTCACGGCAT CCTCCCACAA CAGCCCAGTG AGCTGGTGAA AAGCTATCGC AGACAGATTC 
0181 CTATTCTGAC AGGATTCACT CAACACGATG GTTCCTTTGT GCTAGCAAGC TATTATGATG 
0241 CGCTGGCTGC AAAGGTGGCC AATGTGAGTT CATTAAGTGT CCGTCAGTTT TCCCAGGGTA 
0301 TCAATGATCT GGTCAATGAC ACCTCGGGAC TCACGGATAA CATATTAAAT CGGTTGCTCT 
0361 TTAAGCCTCA GGCGCNTTAA CAGTCATGAT CATAGTGCAG CAGTGTCCTC GTACTTCGAT 
0421 CTCACTACGA ACATCTTCAT GAAGTCCCCG GTAATAACTC TGGCTACCAA AATGTACACC 
0481 CAGCAACGGT CCACGCCAGT TT 
 in silico PCR Fragment
0001 GTTGGGATGT TCTGGCTGTG AGCAACACGA TCAGCTTGTG AAGTGTATTC AAAAAGCGAA 
0061 AGTTATAGAC ATT-CTAAAG GCCACGGCCT CAGAATCCTT TTCGCCGATT GTTGGAGACC 
0121 TTCACGGCAT CCTCCCACAA CAGCCCAGTG AGCTGGTGAA AAGCTATCGC AGACAGATTC 
0181 CTATTCTGAC AGGATTCACT CAACACGATG GTTCCTTTGT GCTAGCAAGC TATTATGATG 
0241 CGCTGGCTGC AAAGGTGGCC AATGTGAGTT CATTAAGTGT CCGTCAGTTT TCCCAGGGTA 
0301 TCAATGATCT GGTCAATGAC ACATCGGGAC TCACGGATAA CATATTAAAT CGGTTGCTCT 
0361 TTAAGCCTCA GGCGC-TTAA CAGTCATGAT CATAGTGCAG CAGTGTCCTC GTACTTCGAT 
0421 CTCACTACGA ACATCTTCAT GAAGTCCCCG GTAATAACTC TGGCTACCAA AATGTACACC 
0481 CAGCAACGGT CCACGCCAGT TT 
 Assemble Data

7529R-3.IR_full       1   GTTGGGATGTTCTGGCTGTGAGCAACACGATCAGCTTGTGAAGTGTATTCAAAAAGCGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     1   GTTGGGATGTTCTGGCTGTGAGCAACACGATCAGCTTGTGAAGTGTATTCAAAAAGCGAA 60


7529R-3.IR_full       61  AGTTATAGACATTNCTAAAGGCCACGGCCTCAGAATCCTTTTCGCCGATTGTTGGAGACC 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     61  AGTTATAGACATT-CTAAAGGCCACGGCCTCAGAATCCTTTTCGCCGATTGTTGGAGACC 120


7529R-3.IR_full       121 TTCACGGCATCCTCCCACAACAGCCCAGTGAGCTGGTGAAAAGCTATCGCAGACAGATTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     121 TTCACGGCATCCTCCCACAACAGCCCAGTGAGCTGGTGAAAAGCTATCGCAGACAGATTC 180


7529R-3.IR_full       181 CTATTCTGACAGGATTCACTCAACACGATGGTTCCTTTGTGCTAGCAAGCTATTATGATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     181 CTATTCTGACAGGATTCACTCAACACGATGGTTCCTTTGTGCTAGCAAGCTATTATGATG 240


7529R-3.IR_full       241 CGCTGGCTGCAAAGGTGGCCAATGTGAGTTCATTAAGTGTCCGTCAGTTTTCCCAGGGTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     241 CGCTGGCTGCAAAGGTGGCCAATGTGAGTTCATTAAGTGTCCGTCAGTTTTCCCAGGGTA 300


7529R-3.IR_full       301 TCAATGATCTGGTCAATGACACCTCGGGACTCACGGATAACATATTAAATCGGTTGCTCT 360
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
7529R-3.in silico     301 TCAATGATCTGGTCAATGACACATCGGGACTCACGGATAACATATTAAATCGGTTGCTCT 360


7529R-3.IR_full       361 TTAAGCCTCAGGCGCNTTAACAGTCATGATCATAGTGCAGCAGTGTCCTCGTACTTCGAT 420
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     361 TTAAGCCTCAGGCGC-TTAACAGTCATGATCATAGTGCAGCAGTGTCCTCGTACTTCGAT 420


7529R-3.IR_full       421 CTCACTACGAACATCTTCATGAAGTCCCCGGTAATAACTCTGGCTACCAAAATGTACACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7529R-3.in silico     421 CTCACTACGAACATCTTCATGAAGTCCCCGGTAATAACTCTGGCTACCAAAATGTACACC 480


7529R-3.IR_full       481 CAGCAACGGTCCACGCCAGTTT 502
                          ||||||||||||||||||||||
7529R-3.in silico     481 CAGCAACGGTCCACGCCAGTTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141064.2  CG7529-RA (CG7529), mRNA 
0   NM_134914.2  CG3332-RA, transcript variant A (CG3332), mRNA 
0   NM_164531.1  CG3332-RB, transcript variant B (CG3332), mRNA 
0   NM_141253.2  CG14662-RA (CG14662), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_168327.1  CG32039-RA (CG32039), mRNA 
0   NM_166975.1  CG10804-RA, transcript variant A (CG10804), mRNA 
0   NM_140981.1  CG5078-RA (CG5078), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_166338.1  CG11949-RD, transcript variant D (cora), mRNA 
0   NM_166336.1  CG11949-RC, transcript variant C (cora), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_164538.2  CG31776-RA (CG31776), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_135162.1  CG13983-RA (CG13983), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_134615.2  CG14615-RA (CG14615), mRNA 
0   NM_168448.1  CG32082-RA (CG32082), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_142131.1  CG7362-RA (CG7362), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_137600.2  CG11218-RA (Obp56d), mRNA 
0   NM_001014469.1  CG14039-RF, transcript variant F (qtc), mRNA 
0   NM_001014467.1  CG14039-RE, transcript variant E (qtc), mRNA 
0   NM_078756.3  CG14039-RA, transcript variant A (qtc), mRNA 
0   NM_142347.1  CG5255-RA (CG5255), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.