National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7511R-2 
 Symbol CG33275  Full Name CG33275 
 CG No CG33275  Old CG No CG7511 
 Synonyms CG7515, CG33167, CG7520, CG7511, CG7513, CG33275 
 Accession No (Link to NCBI) NM_206294.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCCTGTACTACGTGATCGAG 
 Primer Seq. 3'
aatctagaggtaccAGATCATTTCCATGGCGTAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCCTGTACT ACGTGATCGA GAACTATATA GATGAACTGC TTCGCGAGGA TATCCCTCAG 
0061 CCACTGAGGG GCCAGAGAAA TGTGATCTTC GGTAATATCG AGAAGATCTT CGAATTCCAT 
0121 AACTCGCACT TCCTGGGCGA ACTGGAACGC TACGAGAGGA ATCCATTAAA AGTGGGAGCT 
0181 GCCTTTCTGG AGATGGAGTC CAAATTCTAC CTATATGCGC TTTACAACAA GAATAAGCCC 
0241 AAAAGCGATA CTTTACTAAG CGAATATGGT AGCTCATTTT TCAAGCCCAA GCAAATGCAG 
0301 CTTCAGGATA AGCTAGATCT AGCCTCTTAC CTCCTGAAAC CCGTGCAGAG AATGGGAAAA 
0361 TATGCATTGC TCCTGCAGCA GTTGGTCAAA GCCTGCAAAG GTGTGGAAGG AGCAGCTCTA 
0421 CAGGAAATCG CAGCGGATGT AGAAGAGCTG CAGCGAGCAG AAGAAATGGT CAAGTTTCAG 
0481 CTACGCCATG GAAATGATCT  
 in silico PCR Fragment
0001 TCCCTGTACT ACGTGATCGA GAACTATATA GATGAACTGC TTCGCGAGGA TATCCCTCAG 
0061 CCACTGAGGG GCCAGAGAAA TGTGATCTTC GGTAATATCG AGAAGATCTT CGAATTCCAT 
0121 AACTCGCACT TCCTGGGCGA ACTGGAACGC TACGAGAGGA ATCCATTAAA AGTGGGAGCT 
0181 GCCTTTCTGG AGATGGAGTC CAAATTCTAC CTATATGCGC TTTACAACAA GAATAAACCC 
0241 AAAAGCGATA CTTTACTAAG CGAATATGGT AGCTCATTTT TCAAGCCCAA GCAAATGCAG 
0301 CTTCAGGATA AGCTAGATCT AGCCTCTTAC CTCCTGAAAC CCGTGCAGAG AATGGGAAAA 
0361 TATGCATTGC TCCTGCAGCA GTTGGTCAAA GCCTGCAAAG GTGTGGAAGG AGCAGCTCTA 
0421 CAGGAAATCG CAGCGGATGT AGAAGAGCTG CAGCGAGCAG AAGAAATGGT CAAGTTTCAG 
0481 CTACGCCATG GAAATGATCT  
 Assemble Data

7511R-2.IR_full       1   TCCCTGTACTACGTGATCGAGAACTATATAGATGAACTGCTTCGCGAGGATATCCCTCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     1   TCCCTGTACTACGTGATCGAGAACTATATAGATGAACTGCTTCGCGAGGATATCCCTCAG 60


7511R-2.IR_full       61  CCACTGAGGGGCCAGAGAAATGTGATCTTCGGTAATATCGAGAAGATCTTCGAATTCCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     61  CCACTGAGGGGCCAGAGAAATGTGATCTTCGGTAATATCGAGAAGATCTTCGAATTCCAT 120


7511R-2.IR_full       121 AACTCGCACTTCCTGGGCGAACTGGAACGCTACGAGAGGAATCCATTAAAAGTGGGAGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     121 AACTCGCACTTCCTGGGCGAACTGGAACGCTACGAGAGGAATCCATTAAAAGTGGGAGCT 180


7511R-2.IR_full       181 GCCTTTCTGGAGATGGAGTCCAAATTCTACCTATATGCGCTTTACAACAAGAATAAGCCC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
7511R-2.in silico     181 GCCTTTCTGGAGATGGAGTCCAAATTCTACCTATATGCGCTTTACAACAAGAATAAACCC 240


7511R-2.IR_full       241 AAAAGCGATACTTTACTAAGCGAATATGGTAGCTCATTTTTCAAGCCCAAGCAAATGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     241 AAAAGCGATACTTTACTAAGCGAATATGGTAGCTCATTTTTCAAGCCCAAGCAAATGCAG 300


7511R-2.IR_full       301 CTTCAGGATAAGCTAGATCTAGCCTCTTACCTCCTGAAACCCGTGCAGAGAATGGGAAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     301 CTTCAGGATAAGCTAGATCTAGCCTCTTACCTCCTGAAACCCGTGCAGAGAATGGGAAAA 360


7511R-2.IR_full       361 TATGCATTGCTCCTGCAGCAGTTGGTCAAAGCCTGCAAAGGTGTGGAAGGAGCAGCTCTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     361 TATGCATTGCTCCTGCAGCAGTTGGTCAAAGCCTGCAAAGGTGTGGAAGGAGCAGCTCTA 420


7511R-2.IR_full       421 CAGGAAATCGCAGCGGATGTAGAAGAGCTGCAGCGAGCAGAAGAAATGGTCAAGTTTCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7511R-2.in silico     421 CAGGAAATCGCAGCGGATGTAGAAGAGCTGCAGCGAGCAGAAGAAATGGTCAAGTTTCAG 480


7511R-2.IR_full       481 CTACGCCATGGAAATGATCT 500
                          ||||||||||||||||||||
7511R-2.in silico     481 CTACGCCATGGAAATGATCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
100   482  NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
100   482  NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 
0.2   NM_166218.1  CG15611-RB, transcript variant B (CG15611), mRNA 
0.2   NM_137345.2  CG15611-RA, transcript variant A (CG15611), mRNA 
0   NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_139882.1  CG7716-RA (CG7716), mRNA 
0   NM_170636.1  CG3897-RD, transcript variant D (blot), mRNA 
0   NM_079401.2  CG3897-RB, transcript variant B (blot), mRNA 
0   NM_170637.1  CG3897-RA, transcript variant A (blot), mRNA 
0   NM_170638.1  CG3897-RC, transcript variant C (blot), mRNA 
0   NM_132980.1  CG8915-RA (CG8915), mRNA 
0   NM_137209.2  CG8214-RA (CG8214), mRNA 
0   NM_057249.4  CG7793-RA (Sos), mRNA 
0   NM_134503.2  CG14231-RA (CG14231), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 
0   NM_142192.2  CG31301-RA (CG31301), mRNA 
0   NM_137274.2  CG4282-RA (CG4282), mRNA 
0   NM_001014474.2  CG33531-RA (Ddr), mRNA 
0   NM_136477.2  CG30497-RA, transcript variant A (CG30497), mRNA 
0   NM_165555.1  CG30497-RB, transcript variant B (CG30497), mRNA 
0   NM_165556.1  CG30497-RC, transcript variant C (CG30497), mRNA 
0   NM_142915.2  CG31148-RA (CG31148), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   13  NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   13  NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   13  NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_079733.3  CG4677-RA, transcript variant A (lmd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.