National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7502R-3 
 Symbol CG7502  Full Name CG7502 
 CG No CG7502  Old CG No CG7502 
 Synonyms CG7502 
 Accession No (Link to NCBI) NM_133124.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGGCGAAGGACATTAACG 
 Primer Seq. 3'
aatctagaggtaccCTGCTTAAGAGAGCCAAAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGGCGAA GGACATTAAC GATAACGTCG GCATGGAGGC GCACATCTAC GAGAATCTGC 
0061 CGGGCCTGAC CTCCACCCCC AAAGGTCACC TGAATGCGGA gCTGNCGCAA GTATTTTCCG 
0121 CGCGAGGCGA TCTACGAGAA TCTTTGTCGG GGTTGCGGCT ACGGCGTGTT TGCCGCCCAA 
0181 GGACGCTACT GCCATTTCTG CCAGTGCATC GTGAGCGGGG GCGTGGTGAG TACACCGCCT 
0241 CCCCCACCGC CACCGCCCCT TTCGACGATT TCCGGCGAGA GCAGCAACAT CTATGAGAAC 
0301 ATCTGCGATT TGTGCCGCGG CATTTATAGC GACAACGAGC GGTGCCGGTG TCAAAGGTCA 
0361 GAGACGCCAG CCAAAGCGCC CGCACCGTCC ACACCAACCA CACCGCCCAC ACCACCCACC 
0421 AAGGTCAAGT CGCGGTCGCT CTTGGGCTAC TCCAAGTCCA GTGCGGCGAC CTTGACCCGT 
0481 CTCTTTGGCT CTCTTAAGCA G 
 in silico PCR Fragment
0001 AGCAGGCGAA GGACATTAAC GATAACGTCG GCATGGAGGC GCACATCTAC GAGAATCTGC 
0061 CGGGCCTGAC CTCCACCCCC AAAGGTCACC TGAATGCGGA GCTG-CGCAA GTATTTTCCG 
0121 CGCGAGGCGA TCTACGAGAA TCTTTGTCGG GGTTGCGGCT ACGGCGTGTT TGCCGCCCAA 
0181 GGACGCTACT GCCATTTCTG CCAGTGCATC GTGAGCGGGG GCGTGGTGAG TACACCGCCT 
0241 CCCCCACCGC CACCGCCCCT TTCGACGATT TCCGGCGAGA GCAGCAACAT CTATGAGAAC 
0301 ATCTGCGATT TGTGCCGCGG CATTTATAGC GACAACGAGC GGTGCCGGTG TCAAAGGTCA 
0361 GAGACGCCAG CCAAAGCGCC CGCACCGTCC ACACCAACCA CACCGCCCAC ACCACCCACC 
0421 AAGGTCAAGT CGCGGTCGCT CTTGGGCTAC TCCAAGTCCA GTGCGGCGAC CTTGACCCGT 
0481 CTCTTTGGCT CTCTTAAGCA G 
 Assemble Data

7502R-3.IR_full       1   AGCAGGCGAAGGACATTAACGATAACGTCGGCATGGAGGCGCACATCTACGAGAATCTGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     1   AGCAGGCGAAGGACATTAACGATAACGTCGGCATGGAGGCGCACATCTACGAGAATCTGC 60


7502R-3.IR_full       61  CGGGCCTGACCTCCACCCCCAAAGGTCACCTGAATGCGGAGCTGNCGCAAGTATTTTCCG 120
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
7502R-3.in silico     61  CGGGCCTGACCTCCACCCCCAAAGGTCACCTGAATGCGGAGCTG-CGCAAGTATTTTCCG 120


7502R-3.IR_full       121 CGCGAGGCGATCTACGAGAATCTTTGTCGGGGTTGCGGCTACGGCGTGTTTGCCGCCCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     121 CGCGAGGCGATCTACGAGAATCTTTGTCGGGGTTGCGGCTACGGCGTGTTTGCCGCCCAA 180


7502R-3.IR_full       181 GGACGCTACTGCCATTTCTGCCAGTGCATCGTGAGCGGGGGCGTGGTGAGTACACCGCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     181 GGACGCTACTGCCATTTCTGCCAGTGCATCGTGAGCGGGGGCGTGGTGAGTACACCGCCT 240


7502R-3.IR_full       241 CCCCCACCGCCACCGCCCCTTTCGACGATTTCCGGCGAGAGCAGCAACATCTATGAGAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     241 CCCCCACCGCCACCGCCCCTTTCGACGATTTCCGGCGAGAGCAGCAACATCTATGAGAAC 300


7502R-3.IR_full       301 ATCTGCGATTTGTGCCGCGGCATTTATAGCGACAACGAGCGGTGCCGGTGTCAAAGGTCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     301 ATCTGCGATTTGTGCCGCGGCATTTATAGCGACAACGAGCGGTGCCGGTGTCAAAGGTCA 360


7502R-3.IR_full       361 GAGACGCCAGCCAAAGCGCCCGCACCGTCCACACCAACCACACCGCCCACACCACCCACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     361 GAGACGCCAGCCAAAGCGCCCGCACCGTCCACACCAACCACACCGCCCACACCACCCACC 420


7502R-3.IR_full       421 AAGGTCAAGTCGCGGTCGCTCTTGGGCTACTCCAAGTCCAGTGCGGCGACCTTGACCCGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7502R-3.in silico     421 AAGGTCAAGTCGCGGTCGCTCTTGGGCTACTCCAAGTCCAGTGCGGCGACCTTGACCCGT 480


7502R-3.IR_full       481 CTCTTTGGCTCTCTTAAGCAG 501
                          |||||||||||||||||||||
7502R-3.in silico     481 CTCTTTGGCTCTCTTAAGCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.