National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7502R-2 
 Symbol CG7502  Full Name CG7502 
 CG No CG7502  Old CG No CG7502 
 Synonyms CG7502 
 Accession No (Link to NCBI) NM_133124.1 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCAGGCGAAGGACATTAACGATAACGTCGGCATGGAGGCGCACATCTACGAGAATCTGC 60

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     61  CGGGCCTGACCTCCACCCCCAAAGGTCACCTGAATGCGGAGCTG-CGCAAGTATTTTCCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCGAGGCGATCTACGAGAATCTTTGTCGGGGTTGCGGCTACGGCGTGTTTGCCGCCCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGACGCTACTGCCATTTCTGCCAGTGCATCGTGAGCGGGGGCGTGGTGAGTACACCGCCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCCCCACCGCCACCGCCCCTTTCGACGATTTCCGGCGAGAGCAGCAACATCTATGAGAAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCTGCGATTTGTGCCGCGGCATTTATAGCGACAACGAGCGGTGCCGGTGTCAAAGGTCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGACGCCAGCCAAAGCGCCCGCACCGTCCACACCAACCACACCGCCCACACCACCCACC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGGTCAAGTCGCGGTCGCTCTTGGGCTACTCCAAGTCCAGTGCGGCGACCTTGACCCGT 480

7502R-2.IR_full       481 CTCTTTGGCTCTCTTAAGCAG 501
                          ||||||||||||||||||||| silico     481 CTCTTTGGCTCTCTTAAGCAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  22  NM_133124.1  CG7502-RA (CG7502), mRNA 
0.2   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   NM_138134.1  CG18506-RA (CG18506), mRNA 
0   NM_168717.1  CG7725-RB, transcript variant B (rogdi), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_168168.1  CG32396-RA (CG32396), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   NM_078798.3  CG3763-RA (Fbp2), mRNA 
0   NM_139458.2  CG1317-RB (CG1317), mRNA 
0   NM_079051.2  CG4903-RA (MESR4), mRNA 
0   19  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   11  NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   11  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_137709.2  CG9418-RA (CG9418), mRNA 
0   NM_136859.2  CG8991-RA (Sobp), mRNA 
0   20  NM_001014571.1  CG33556-RA (form3), mRNA 
0   10  NM_165304.1  CG10084-RB, transcript variant B (swm), mRNA 
0   10  NM_136132.4  CG10084-RA, transcript variant A (swm), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_141374.1  CG1154-RA (Osi12), mRNA 
0   12  NM_138132.1  CG9083-RA (CG9083), mRNA 
0   10  NM_132380.1  CG15311-RA (CG15311), mRNA 
0   NM_166201.1  CG6622-RB, transcript variant B (Pkc53E), mRNA 
0   NM_057334.2  CG6622-RA, transcript variant A (Pkc53E), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   NM_165793.1  CG11883-RA, transcript variant A (CG11883), mRNA 
0   NM_136754.3  CG11883-RB, transcript variant B (CG11883), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.