National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7492R-2 
 Symbol CG7492  Full Name CG7492 
 CG No CG7492  Old CG No CG7492 
 Synonyms anon-EST:fe1A11, CG7492 
 Accession No (Link to NCBI) NM_139889.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGGTATACTCAACACGCGGA 
 Primer Seq. 3'
aatctagaggtaccGAGTTGGATGCTGCGCATGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGGTATACT CAACACGCGG AGAAGACTCG AGTGGACCAA GGAGTGGCTG CGCAAAAACC 
0061 AGACCGAGTT TCTCAGCAAG GAGAATTTAC TTAGTGAACT GCAGTCGCGC AAGGATGAGT 
0121 GCTATCACTT GAATTACTTT CTAGCCATAA CAGAGAGCCA GTTTCGGTAT CTAGTGCAAA 
0181 AGCTGGAGCC CATCATTAGC CANGTATGCT GCCGCAACGC AAGAAGAAGT CCTTCAGCGC 
0241 CTGAGGAACG ACTGGCCATA ACGCTCAAGT ATTTGGCAAC GGGTGAAGTA CATTCTTGTC 
0301 GAAACTACTG CTTCCGTGCC TCGAAATTTG TGATAAACGA AATGATTGCC AATATCTGTC 
0361 TGGGCTTCTA CGAGCACCTC AAGGACCAAT ACGTGACACT ACCAAAGACT GACGATCAGN 
0421 TGGCGCAGNG CCGCCGAAGG AGATGGAGCG TAAGCACAAC CTGCCCCACT GTGTGGGCAA 
0481 TCTGTTCATg NGCAGCATCC AACTC 
 in silico PCR Fragment
0001 CCGGTATACT CAACACGCGG AGAAGACTCG AGTGGACCAA GGAGTGGCTG CGCAAAAACC 
0061 AGACCGAGTT TCTCAGCAAG GAGAATTTAC TTAGTGAACT GCAGTCGCGC AAGGATGAGT 
0121 GCTATCACTT GAATTACTTT CTAGCCATAA CAGAGAGCCA GTTTCGGTAT CTAGTGCAAA 
0181 AGCTGGAGCC CATCATTAGC CA-GTATGCT -CCGCAACGC AAGAAGAAGT CCTTCAGCGC 
0241 C-GAGGAACG ACTGGCCATA ACGCTCAAGT ATTTGGCAAC GGGTGAAGTA CATTCTTGTC 
0301 GAAACTACTG CTTCCGTGCC TCGAAATTTG TGATAAACGA AATGATTGCC AATATCTGTC 
0361 TGGGCTTCTA CGAGCACCTC AAGGACCAAT ACGTGACACT ACCAAAGACT GACGATCAG- 
0421 TGGCGCAGCG CCGCCG-AGG AGATGGAGCG TAAGCACAAC CTGCCCCACT GTGTGGGCAA 
0481 TCTGTTCATG CGCAGCATCC AACTC 
 Assemble Data

7492R-2.IR_full       1   CCGGTATACTCAACACGCGGAGAAGACTCGAGTGGACCAAGGAGTGGCTGCGCAAAAACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     1   CCGGTATACTCAACACGCGGAGAAGACTCGAGTGGACCAAGGAGTGGCTGCGCAAAAACC 60


7492R-2.IR_full       61  AGACCGAGTTTCTCAGCAAGGAGAATTTACTTAGTGAACTGCAGTCGCGCAAGGATGAGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     61  AGACCGAGTTTCTCAGCAAGGAGAATTTACTTAGTGAACTGCAGTCGCGCAAGGATGAGT 120


7492R-2.IR_full       121 GCTATCACTTGAATTACTTTCTAGCCATAACAGAGAGCCAGTTTCGGTATCTAGTGCAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     121 GCTATCACTTGAATTACTTTCTAGCCATAACAGAGAGCCAGTTTCGGTATCTAGTGCAAA 180


7492R-2.IR_full       181 AGCTGGAGCCCATCATTAGCCANGTATGCTGCCGCAACGCAAGAAGAAGTCCTTCAGCGC 240
                          |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||
7492R-2.in silico     181 AGCTGGAGCCCATCATTAGCCA-GTATGCT-CCGCAACGCAAGAAGAAGTCCTTCAGCGC 240


7492R-2.IR_full       241 CTGAGGAACGACTGGCCATAACGCTCAAGTATTTGGCAACGGGTGAAGTACATTCTTGTC 300
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     241 C-GAGGAACGACTGGCCATAACGCTCAAGTATTTGGCAACGGGTGAAGTACATTCTTGTC 300


7492R-2.IR_full       301 GAAACTACTGCTTCCGTGCCTCGAAATTTGTGATAAACGAAATGATTGCCAATATCTGTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     301 GAAACTACTGCTTCCGTGCCTCGAAATTTGTGATAAACGAAATGATTGCCAATATCTGTC 360


7492R-2.IR_full       361 TGGGCTTCTACGAGCACCTCAAGGACCAATACGTGACACTACCAAAGACTGACGATCAGN 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
7492R-2.in silico     361 TGGGCTTCTACGAGCACCTCAAGGACCAATACGTGACACTACCAAAGACTGACGATCAG- 420


7492R-2.IR_full       421 TGGCGCAGNGCCGCCGAAGGAGATGGAGCGTAAGCACAACCTGCCCCACTGTGTGGGCAA 480
                          |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||
7492R-2.in silico     421 TGGCGCAGCGCCGCCG-AGGAGATGGAGCGTAAGCACAACCTGCCCCACTGTGTGGGCAA 480


7492R-2.IR_full       481 TCTGTTCATGNGCAGCATCCAACTC 505
                          |||||||||| ||||||||||||||
7492R-2.in silico     481 TCTGTTCATGCGCAGCATCCAACTC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139889.1  CG7492-RA (CG7492), mRNA 
0   NM_133003.2  CG32555-RB, transcript variant B (RhoGAPp190), mRNA 
0   NM_167573.1  CG32555-RC, transcript variant C (RhoGAPp190), mRNA 
0   NM_167572.1  CG32555-RA, transcript variant A (RhoGAPp190), mRNA 
0   NM_165439.1  CG17510-RB, transcript variant B (CG17510), mRNA 
0   NM_167342.1  CG4407-RB, transcript variant B (CG4407), mRNA 
0   NM_132609.2  CG4407-RA, transcript variant A (CG4407), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
0   NM_163879.1  CG32491-RD, transcript variant D (mod(mdg4)), mRNA 
0   NM_080197.2  CG32491-RF, transcript variant F (mod(mdg4)), mRNA 
0   NM_163878.1  CG32491-RA, transcript variant A (mod(mdg4)), mRNA 
0   NM_163877.1  CG32491-RR, transcript variant R (mod(mdg4)), mRNA 
0   NM_163881.1  CG32491-RQ, transcript variant Q (mod(mdg4)), mRNA 
0   NM_163882.1  CG32491-RH, transcript variant H (mod(mdg4)), mRNA 
0   NM_163880.1  CG32491-RG, transcript variant G (mod(mdg4)), mRNA 
0   NM_163894.1  CG32491-RN, transcript variant N (mod(mdg4)), mRNA 
0   NM_163893.1  CG32491-RO, transcript variant O (mod(mdg4)), mRNA 
0   NM_163892.1  CG32491-RS, transcript variant S (mod(mdg4)), mRNA 
0   NM_176527.1  CG32491-RU, transcript variant U (mod(mdg4)), mRNA 
0   NM_176526.1  CG32491-RV, transcript variant V (mod(mdg4)), mRNA 
0   NM_176525.1  CG32491-RW, transcript variant W (mod(mdg4)), mRNA 
0   NM_176524.1  CG32491-RX, transcript variant X (mod(mdg4)), mRNA 
0   NM_176523.1  CG32491-RY, transcript variant Y (mod(mdg4)), mRNA 
0   NM_163891.1  CG32491-RC, transcript variant C (mod(mdg4)), mRNA 
0   NM_163890.1  CG32491-RE, transcript variant E (mod(mdg4)), mRNA 
0   NM_163889.1  CG32491-RM, transcript variant M (mod(mdg4)), mRNA 
0   NM_176522.1  CG32491-RZ, transcript variant Z (mod(mdg4)), mRNA 
0   NM_176521.1  CG32491-RT, transcript variant T (mod(mdg4)), mRNA 
0   NM_163887.1  CG32491-RL, transcript variant L (mod(mdg4)), mRNA 
0   NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.