National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7487R-3 
 Symbol RecQ4  Full Name RecQ4 
 CG No CG7487  Old CG No CG7487 
 Synonyms cg7487, DmRECQ4, CG7487, RecQ4 
 Accession No (Link to NCBI) NM_144350.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kondo S, Perrimon N.
A genome-wide RNAi screen identifies core components of the G₂-M DNA damage checkpoint.
Sci Signal (2011) 4(154) rs1 [ PubMed ID = 21205937 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAAGTTGCGCGTCAAGGTG 
 Primer Seq. 3'
aatctagaggtaccGGTGGAGCTGGTGGCTTCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAAGTTGC GCGTCAAGGT GTGGGAGAAG GACTTCAAGA AGAAGAATGG CCGTGTTCCA 
0061 TCGAAGTATG ATATAAGGGA CGCCAGTCAG NGAGATTCGG GACTCATACA AAATGTACTA 
0121 CAAACTGAAG ACATCCTTCC TGGAAGAGAC GCTGAACGAT GTTCTCAGCG AAGATGGATA 
0181 CGATATTCTG GAGATGTCGC AGGCCAGTGA TTTCGGTGTG AGCATGCTGG ACCAGGACGT 
0241 CAGTCTTAAT GAAGGTCCTC AGCTACCGTT GGATATATCT GCACTGGTGG GGCCGCAGAG 
0301 CTCTGGTAAT CTTGAGGAAA TTCCACAATC GGTGGAGGGC TCATTCTCAA ATCTCATCGA 
0361 CCTGCCCAAT CGTCAAGTAC TCACCAATCT GGTCAATCGC GATGAAAACC ATGTCATTCG 
0421 CAAATTCGAG GCGGTGGAGG AGCTGCCAAT CAACCAAAAT gCCTGGGGCT TGAATGTGAG 
0481 TAAGAAGCCA CCAGCTCCAC C 
 in silico PCR Fragment
0001 TACAAGTTGC GCGTCAAGGT GTGGGAGAAG GACTTCAAGA AGAAGAATGG CCGTGTTCCA 
0061 TCGAAGTATG ATATAAGGGA CGCCAGTCAG -GAGATTCGG GACTCATACA AAATGTACTA 
0121 CAAACTGAAG ACATCCTTCC TGGAAGAGAC GCTGAACGAT GTTCTCAGCG AAGATGGATA 
0181 CGATATTCTG GAGATGTCGC AGGCCAGTGA TTTCGGTGTG AGCATGCTGG ACCAGGACGT 
0241 CAGTCTTAAT GAAGGTCCTC AGCTACCGTT GGATATATCT GCACTGGTGG GGCCGCAGAG 
0301 CTCTGGTAAT CTTGAGGAAA TTCCACAATC GGTGGAGGGC TCATTCTCAA ATCTCATCGA 
0361 CCTGCCCAAT CGTCAAGTAC TCACCAATCT GGTCAATCGC GATGAAAACC ATGTCATTCG 
0421 CAAATTCGAG GCGGTGGAGG AGCTGCCAAT CAACCAAAAT GCCTGGGGCT TGAATGTGAG 
0481 TAAGAAGCCA CCAGCTCCAC C 
 Assemble Data

7487R-3.IR_full       1   TACAAGTTGCGCGTCAAGGTGTGGGAGAAGGACTTCAAGAAGAAGAATGGCCGTGTTCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     1   TACAAGTTGCGCGTCAAGGTGTGGGAGAAGGACTTCAAGAAGAAGAATGGCCGTGTTCCA 60


7487R-3.IR_full       61  TCGAAGTATGATATAAGGGACGCCAGTCAGNGAGATTCGGGACTCATACAAAATGTACTA 120
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
7487R-3.in silico     61  TCGAAGTATGATATAAGGGACGCCAGTCAG-GAGATTCGGGACTCATACAAAATGTACTA 120


7487R-3.IR_full       121 CAAACTGAAGACATCCTTCCTGGAAGAGACGCTGAACGATGTTCTCAGCGAAGATGGATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     121 CAAACTGAAGACATCCTTCCTGGAAGAGACGCTGAACGATGTTCTCAGCGAAGATGGATA 180


7487R-3.IR_full       181 CGATATTCTGGAGATGTCGCAGGCCAGTGATTTCGGTGTGAGCATGCTGGACCAGGACGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     181 CGATATTCTGGAGATGTCGCAGGCCAGTGATTTCGGTGTGAGCATGCTGGACCAGGACGT 240


7487R-3.IR_full       241 CAGTCTTAATGAAGGTCCTCAGCTACCGTTGGATATATCTGCACTGGTGGGGCCGCAGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     241 CAGTCTTAATGAAGGTCCTCAGCTACCGTTGGATATATCTGCACTGGTGGGGCCGCAGAG 300


7487R-3.IR_full       301 CTCTGGTAATCTTGAGGAAATTCCACAATCGGTGGAGGGCTCATTCTCAAATCTCATCGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     301 CTCTGGTAATCTTGAGGAAATTCCACAATCGGTGGAGGGCTCATTCTCAAATCTCATCGA 360


7487R-3.IR_full       361 CCTGCCCAATCGTCAAGTACTCACCAATCTGGTCAATCGCGATGAAAACCATGTCATTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     361 CCTGCCCAATCGTCAAGTACTCACCAATCTGGTCAATCGCGATGAAAACCATGTCATTCG 420


7487R-3.IR_full       421 CAAATTCGAGGCGGTGGAGGAGCTGCCAATCAACCAAAATGCCTGGGGCTTGAATGTGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7487R-3.in silico     421 CAAATTCGAGGCGGTGGAGGAGCTGCCAATCAACCAAAATGCCTGGGGCTTGAATGTGAG 480


7487R-3.IR_full       481 TAAGAAGCCACCAGCTCCACC 501
                          |||||||||||||||||||||
7487R-3.in silico     481 TAAGAAGCCACCAGCTCCACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_144350.1  CG7487-RA (RecQ4), mRNA 
0.2   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_143386.2  CG14528-RA (CG14528), mRNA 
0   NM_142578.2  CG11447-RA (CG11447), mRNA 
0   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   NM_132292.2  CG7246-RA (CG7246), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_170034.1  CG4919-RA (Gclm), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_079585.2  CG4591-RA (Tsp86D), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_170614.2  CG30492-RB, transcript variant B (CG30492), mRNA 
0   NM_170613.2  CG30492-RA, transcript variant A (CG30492), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_132114.1  CG14442-RA (CG14442), mRNA 
0   NM_168964.2  CG11352-RB, transcript variant B (jim), mRNA 
0   NM_176119.2  CG33135-RB, transcript variant B (KCNQ), mRNA 
0   NM_176120.2  CG33135-RA, transcript variant A (KCNQ), mRNA 
0   NM_143699.2  CG11352-RC, transcript variant C (jim), mRNA 
0   NM_164444.1  CG31663-RA (CG31663), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_001014601.1  CG11352-RD, transcript variant D (jim), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_165621.1  CG30357-RA (CG30357), mRNA 
0   NM_141001.2  CG4365-RA, transcript variant A (CG4365), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.