National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7470R-3 
 Symbol CG7470  Full Name CG7470 
 CG No CG7470  Old CG No CG7470 
 Synonyms CG7470 
 Accession No (Link to NCBI) NM_141118.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGGCCCAGAGCCTTCGAAACGGCTTCTACAGAAACGCCTGGCGAGCGTTCAGCTCCCAC 60

                          |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| silico     61  GGACCCCGGCAGCCACTGGTTTCGCCGGAGCGGCGCTTGGAAAAGGCGCATCCAACCTTC 120

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     121 ACGGAAAGGAGTCAGTTGAAGTACGCCCGGAGGCTGGTGGTCAAGTTGGGCAGTGCAGTC 180

                          ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| silico     181 ATTACTCGAGAGGACAACCATGGACTAGCCCTCGGCCGTCTGGCCTC-TATTGTGGAGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTTGCCGAGTGCCATTTGGAAGGACGTGAAGTGATGATGGTCACCAGCGGAGCGGTGGC 300

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CT-TTGGAAAGCAGAAGCTCGCCCAGGAGCTGCTCATGTCGCTGTCCATGCGCGAGACAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TAAACCCAAAAGATAGCAAAGAGTTTGACGGCGCTACGCTGGAACCGCGAGCAGCGGCTG 420

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGTGG-GTCAGTCGGGTCTGATGTCCCTCTACGACGCGATGTTTGCCCAGTACGGCGTC 480

7470R-3.IR_full       481 AAGATAGCCCAGGTGCTCGTGAC 503
                          ||||||||||||||||||||||| silico     481 AAGATAGCCCAGGTGCTCGTGAC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141118.3  CG7470-RA (CG7470), mRNA 
0   NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0   NM_134804.3  CG7261-RA (CG7261), mRNA 
0   NM_140919.1  CG7385-RA (CG7385), mRNA 
0   NM_132010.1  CG17758-RA (CG17758), mRNA 
0   NM_137591.1  CG15124-RA (CG15124), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
0   NM_001043153.1  CG32434-RC, transcript variant C (siz), mRNA 
0   NM_132492.1  CG1756-RA (CG1756), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_169051.1  CG31542-RA (CG31542), mRNA 
0   11  NM_001014716.1  CG33513-RA, transcript variant A (Nmdar2), mRNA 
0   11  NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0   11  NM_001014715.1  CG33513-RB, transcript variant B (Nmdar2), mRNA 
0   10  NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   10  NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   10  NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
0   NM_057882.3  CG1609-RA (Gcn2), mRNA 
0   NM_167394.1  CG32603-RA (CG32603), mRNA 
0   NM_078800.2  CG4422-RA (Gdi), mRNA 
0   NM_137942.1  CG13550-RA (CG13550), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.