National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7470R-2 
 Symbol CG7470  Full Name CG7470 
 CG No CG7470  Old CG No CG7470 
 Synonyms CG7470 
 Accession No (Link to NCBI) NM_141118.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGCCCAGAGCCTTCGAAAC 
 Primer Seq. 3'
aatctagaggtaccGTCACGAGCACCTGGGCTATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGGCCCAGA GCCTTCGAAA CGGCTTCTAC AGAAACGCCT GGCGAGCGTT CAGcTCCCAC 
0061 GGACCCCGGC AGCCACTGGT TTCGCCGGAG CGNCgCNTGG AAAAGGCGCA TCCAACCTTC 
0121 ACGGAAAGGA GTCAGTTGAA GTACGCCCGG AgGNTGGTGG TCAAGTTGGG CAGTGCAGTC 
0181 ATTACTCGAG AGGACAACCA TGGACTAGCC CTCgGNCGTC TgGCCTCNTA TTGTGGAGCA 
0241 GGTTGCCGAG TGCCATTTGG AAGGACGTGA AGTGATGATG GTCACCAGCG GAGCGGTGGC 
0301 CTNTTGGAAA GCAGAAGCTC GCCCAGGAGC TGCTCATGTC GCTGTCCATG CGCGAGACAC 
0361 TAAACCCAAA AGATAGCAAA GAGTTTGACG GCGCTACGCT GGAACCGCGA GCAGCGGCTG 
0421 CGGTGGNGTC AGTCGGGTCT GATGTCCCTC TACGACGCGA TGTTTGCCCA GTACGGCGTC 
0481 AAGATAGCCC AGGTGCTCGT GAC 
 in silico PCR Fragment
0001 CTGGCCCAGA GCCTTCGAAA CGGCTTCTAC AGAAACGCCT GGCGAGCGTT CAGCTCCCAC 
0061 GGACCCCGGC AGCCACTGGT TTCGCCGGAG CGGCGCTTGG AAAAGGCGCA TCCAACCTTC 
0121 ACGGAAAGGA GTCAGTTGAA GTACGCCCGG AGGCTGGTGG TCAAGTTGGG CAGTGCAGTC 
0181 ATTACTCGAG AGGACAACCA TGGACTAGCC CTCGGCCGTC TGGCCTC-TA TTGTGGAGCA 
0241 GGTTGCCGAG TGCCATTTGG AAGGACGTGA AGTGATGATG GTCACCAGCG GAGCGGTGGC 
0301 CT-TTGGAAA GCAGAAGCTC GCCCAGGAGC TGCTCATGTC GCTGTCCATG CGCGAGACAC 
0361 TAAACCCAAA AGATAGCAAA GAGTTTGACG GCGCTACGCT GGAACCGCGA GCAGCGGCTG 
0421 CGGTGG-GTC AGTCGGGTCT GATGTCCCTC TACGACGCGA TGTTTGCCCA GTACGGCGTC 
0481 AAGATAGCCC AGGTGCTCGT GAC 
 Assemble Data

7470R-2.IR_full       1   CTGGCCCAGAGCCTTCGAAACGGCTTCTACAGAAACGCCTGGCGAGCGTTCAGCTCCCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7470R-2.in silico     1   CTGGCCCAGAGCCTTCGAAACGGCTTCTACAGAAACGCCTGGCGAGCGTTCAGCTCCCAC 60


7470R-2.IR_full       61  GGACCCCGGCAGCCACTGGTTTCGCCGGAGCGNCGCNTGGAAAAGGCGCATCCAACCTTC 120
                          |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||
7470R-2.in silico     61  GGACCCCGGCAGCCACTGGTTTCGCCGGAGCGGCGCTTGGAAAAGGCGCATCCAACCTTC 120


7470R-2.IR_full       121 ACGGAAAGGAGTCAGTTGAAGTACGCCCGGAGGNTGGTGGTCAAGTTGGGCAGTGCAGTC 180
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
7470R-2.in silico     121 ACGGAAAGGAGTCAGTTGAAGTACGCCCGGAGGCTGGTGGTCAAGTTGGGCAGTGCAGTC 180


7470R-2.IR_full       181 ATTACTCGAGAGGACAACCATGGACTAGCCCTCGGNCGTCTGGCCTCNTATTGTGGAGCA 240
                          ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
7470R-2.in silico     181 ATTACTCGAGAGGACAACCATGGACTAGCCCTCGGCCGTCTGGCCTC-TATTGTGGAGCA 240


7470R-2.IR_full       241 GGTTGCCGAGTGCCATTTGGAAGGACGTGAAGTGATGATGGTCACCAGCGGAGCGGTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7470R-2.in silico     241 GGTTGCCGAGTGCCATTTGGAAGGACGTGAAGTGATGATGGTCACCAGCGGAGCGGTGGC 300


7470R-2.IR_full       301 CTNTTGGAAAGCAGAAGCTCGCCCAGGAGCTGCTCATGTCGCTGTCCATGCGCGAGACAC 360
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7470R-2.in silico     301 CT-TTGGAAAGCAGAAGCTCGCCCAGGAGCTGCTCATGTCGCTGTCCATGCGCGAGACAC 360


7470R-2.IR_full       361 TAAACCCAAAAGATAGCAAAGAGTTTGACGGCGCTACGCTGGAACCGCGAGCAGCGGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7470R-2.in silico     361 TAAACCCAAAAGATAGCAAAGAGTTTGACGGCGCTACGCTGGAACCGCGAGCAGCGGCTG 420


7470R-2.IR_full       421 CGGTGGNGTCAGTCGGGTCTGATGTCCCTCTACGACGCGATGTTTGCCCAGTACGGCGTC 480
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
7470R-2.in silico     421 CGGTGG-GTCAGTCGGGTCTGATGTCCCTCTACGACGCGATGTTTGCCCAGTACGGCGTC 480


7470R-2.IR_full       481 AAGATAGCCCAGGTGCTCGTGAC 503
                          |||||||||||||||||||||||
7470R-2.in silico     481 AAGATAGCCCAGGTGCTCGTGAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.