National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7460R-1 
 Symbol CG7460  Full Name CG7460 
 CG No CG7460  Old CG No CG7460 
 Synonyms CG7460 
 Accession No (Link to NCBI) NM_140747.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGATTCCCTTTGCCGATAAC 
 Primer Seq. 3'
aatctagaggtaccTCCTCTGGCGCTTTCATGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGATTCCCT TTGCCGATAA CGTCGTCGAC CTGGGCGCCC AGTGGTGCCA TGGCGAGAAA 
0061 GGAAATGTAG TATACGACAA GGTCAAGGAC CTGAACCTCC TGGAGGTCAC GGAACCGCAC 
0121 TATGAAACCT TTAGATGCGT TCGATCCAAC AAAGAAGTCC TACCCGACGA CCTAGCAGAT 
0181 CAACTGAAAA CTATAGCTGA TATGTCAATA CCAGACCGGC AGGCAGAGCT CCTGGACTTC 
0241 GAGGGTTCGT TGGGAGACTA CATCAATATG AAGTACTGGA AGGAGCTGGC CAAGCTTCCG 
0301 CCCATAGATC GTACCATTGC GGAGGAGTTC CTGGAGGTGT TTCACAAATT CGAAGCATCC 
0361 GTGGAGGCAG CGGATCACCT GTTTGAAGTA TCCGGAAAGG GTCACTTGGA GTACTGGCTA 
0421 TGCGAAGGCG AGCTGCTCCT CAATTGGAAG GACAAGGGAT ACAAAAGATT CCTCAAACTA 
0481 CTCATGAAAG CGCCAGAGGA  
 in silico PCR Fragment
0001 ACGATTCCCT TTGCCGATAA CGTCGTCGAC CTGGGCGCCC AGTGGTGCCA TGGCGAGAAA 
0061 GGAAATGTAG TATACGACAA GGTCAAGGAC CTGAACCTCC TGGAGGTCAC GGAACCGCAC 
0121 TATGAAACCT TTAGATGCGT TCGATCCAAC AAAGAAGTCC TACCCGACGA CCTAGCAGAT 
0181 CAACTGAAAA CTATAGCTGA TATGTCAATA CCAGACCGGC AGGCAGAGCT CCTGGACTTC 
0241 GAGGGTTCGT TGGGAGACTA CATCAATATG AAGTACTGGA AGGAGCTGGC CAAGCTTCCG 
0301 CCCATAGATC GTACCATTGC GGAGGAGTTC CTGGAGGTGT TTCACAAATT CGAAGCATCC 
0361 GTGGAGGCAG CGGATCACCT GTTTGAAGTA TCCGGAAAGG GTCACTTGGA GTACTGGCTA 
0421 TGCGAAGGCG AGCTGCTCCT CAATTGGAAG GACAAGGGAT ACAAAAGATT CCTCAAACTA 
0481 CTCATGAAAG CGCCAGAGGA  
 Assemble Data

7460R-1.IR_full       1   ACGATTCCCTTTGCCGATAACGTCGTCGACCTGGGCGCCCAGTGGTGCCATGGCGAGAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     1   ACGATTCCCTTTGCCGATAACGTCGTCGACCTGGGCGCCCAGTGGTGCCATGGCGAGAAA 60


7460R-1.IR_full       61  GGAAATGTAGTATACGACAAGGTCAAGGACCTGAACCTCCTGGAGGTCACGGAACCGCAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     61  GGAAATGTAGTATACGACAAGGTCAAGGACCTGAACCTCCTGGAGGTCACGGAACCGCAC 120


7460R-1.IR_full       121 TATGAAACCTTTAGATGCGTTCGATCCAACAAAGAAGTCCTACCCGACGACCTAGCAGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     121 TATGAAACCTTTAGATGCGTTCGATCCAACAAAGAAGTCCTACCCGACGACCTAGCAGAT 180


7460R-1.IR_full       181 CAACTGAAAACTATAGCTGATATGTCAATACCAGACCGGCAGGCAGAGCTCCTGGACTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     181 CAACTGAAAACTATAGCTGATATGTCAATACCAGACCGGCAGGCAGAGCTCCTGGACTTC 240


7460R-1.IR_full       241 GAGGGTTCGTTGGGAGACTACATCAATATGAAGTACTGGAAGGAGCTGGCCAAGCTTCCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     241 GAGGGTTCGTTGGGAGACTACATCAATATGAAGTACTGGAAGGAGCTGGCCAAGCTTCCG 300


7460R-1.IR_full       301 CCCATAGATCGTACCATTGCGGAGGAGTTCCTGGAGGTGTTTCACAAATTCGAAGCATCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     301 CCCATAGATCGTACCATTGCGGAGGAGTTCCTGGAGGTGTTTCACAAATTCGAAGCATCC 360


7460R-1.IR_full       361 GTGGAGGCAGCGGATCACCTGTTTGAAGTATCCGGAAAGGGTCACTTGGAGTACTGGCTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     361 GTGGAGGCAGCGGATCACCTGTTTGAAGTATCCGGAAAGGGTCACTTGGAGTACTGGCTA 420


7460R-1.IR_full       421 TGCGAAGGCGAGCTGCTCCTCAATTGGAAGGACAAGGGATACAAAAGATTCCTCAAACTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7460R-1.in silico     421 TGCGAAGGCGAGCTGCTCCTCAATTGGAAGGACAAGGGATACAAAAGATTCCTCAAACTA 480


7460R-1.IR_full       481 CTCATGAAAGCGCCAGAGGA 500
                          ||||||||||||||||||||
7460R-1.in silico     481 CTCATGAAAGCGCCAGAGGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140747.1  CG7460-RB (CG7460), mRNA 
0.2   NM_079427.2  CG6850-RA (Ugt), mRNA 
0   NM_167317.1  CG1488-RA, transcript variant A (Cyp311a1), mRNA 
0   NM_132552.2  CG1488-RB, transcript variant B (Cyp311a1), mRNA 
0   14  NM_140012.1  CG5653-RA (CG5653), mRNA 
0   NM_079864.2  CG1470-RA (Gycbeta100B), mRNA 
0   NM_165636.1  CG8251-RC, transcript variant C (Pgi), mRNA 
0   NM_165635.1  CG8251-RB, transcript variant B (Pgi), mRNA 
0   NM_078939.2  CG8251-RA, transcript variant A (Pgi), mRNA 
0   NM_136491.1  CG14766-RA (CG14766), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_142663.3  CG15695-RA (CG15695), mRNA 
0   NM_142121.1  CG7886-RA (CG7886), mRNA 
0   NM_140646.2  CG4229-RA (CG4229), mRNA 
0   NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   NM_170231.2  CG4673-RB, transcript variant B (CG4673), mRNA 
0   NM_143150.3  CG4673-RA, transcript variant A (CG4673), mRNA 
0   NM_139449.1  CG13807-RA (CG13807), mRNA 
0   NM_137570.1  CG10051-RA (CG10051), mRNA 
0   NM_170115.2  CG5977-RA, transcript variant A (spas), mRNA 
0   NM_142949.3  CG5977-RB, transcript variant B (spas), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_142106.1  CG14843-RA (CG14843), mRNA 
0   NM_137992.1  CG5549-RA (CG5549), mRNA 
0   NM_169013.1  CG1057-RB, transcript variant B (MED31), mRNA 
0   NM_141226.2  CG1057-RA, transcript variant A (MED31), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_132709.1  CG12480-RA (CG12480), mRNA 
0   NM_142661.2  CG17273-RA (CG17273), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.