National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7436R-1 
 Symbol Nmt  Full Name N-myristoyl transferase 
 CG No CG7436  Old CG No CG7436 
 Synonyms 153290_at, dNMT, l(3)j1C7, Nmt1, l(3)j1c7, CG7436, Nmt 
 Accession No (Link to NCBI) NM_079245.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGACCTCTCGGGTCAAGAG 
 Primer Seq. 3'
aatctagaggtaccGGTGGCTGCAGCGACCACTTT 
 Predicted Fragment Size
521 
 IR fragment full Seq
0001 GAGGACCTCT CGGGTCAAGA GCTAAAGCAG AAGGCCAAGG AGGTGGCCGA CGCATCGGAG 
0061 GCAATGCTCG AAAAGGTTGT TGCCGGCTTA AATATCCAGG ACACGGCATC GACGAATGCA 
0121 GCAGGAAACG AGGATGCGGA GCAGCCTGAT GGTGCCAAGA ATGAGGCTTC AGTGTCTGCG 
0181 AATGCAAGCA AACAGGCCTT GCTACAAGCC GTTTCCGATG CTATGGCCAG TACCCGTCAG 
0241 ATGGCCAAGA AGTTTGCATT TTGGTCCACA CAGCCAGTCA CCAAGCTGGA CGAGCAGGTG 
0301 ACCACCAACG AATGCATTGA ACCGAACAAG GAAATTAGTG AGATTAGAGC ATTGCCATAC 
0361 ACTCTGCCAG GCGGCTTCAA ATGGGTGACA CTAGACCTGA ACGACGCCAA TGATCTCAAG 
0421 GAGCTGTACA CGCTGCTCAA TGAGAACTAT GTGGAGGACG ATGATGCCAT GTTCCGTTTC 
0481 GATTACCAAC CCGAGTTTCT AAAGTGGTCG CTGCAGCCAC C 
 in silico PCR Fragment
0001 GAGGACCTCT CGGGTCAAGA GCTAAAGCAG AAGGCCAAGG AGGTGGCCGA CGCATCGGAG 
0061 GCAATGCTCG AAAAGGTTGT TGCCGGCTTA AATATCCAGG ACACGGCATC GACGAATGCA 
0121 GCAGGAAACG AGGATGCGGA GCAGCCTGAT GGTGCCAAGA ATGAGGCTTC AGTGTCTGCG 
0181 AATGCAAGCA AACAGGCCTT GCTACAAGCC GTTTCCGATG CTATGGCCAG CACCCGTCAG 
0241 ATGGCCAAGA AGTTTGCATT TTGGTCCACA CAGCCAGTCA CCAAGCTGGA CGAGCAGGTG 
0301 ACCACCAACG AATGCATTGA ACCGAACAAG GAAATTAGTG AGATTAGAGC ATTGCCATAC 
0361 ACTCTGCCAG GCGGCTTCAA ATGGGTGACA CTAGACCTGA ACGACGCCAA TGATCTCAAG 
0421 GAGCTGTACA CGCTGCTCAA TGAGAACTAT GTGGAGGACG ATGATGCCAT GTTCCGTTTC 
0481 GATTACCAAC CCGAGTTTCT AAAGTGGTCG CTGCAGCCAC C 
 Assemble Data

7436R-1.IR_full       1   GAGGACCTCTCGGGTCAAGAGCTAAAGCAGAAGGCCAAGGAGGTGGCCGACGCATCGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     1   GAGGACCTCTCGGGTCAAGAGCTAAAGCAGAAGGCCAAGGAGGTGGCCGACGCATCGGAG 60


7436R-1.IR_full       61  GCAATGCTCGAAAAGGTTGTTGCCGGCTTAAATATCCAGGACACGGCATCGACGAATGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     61  GCAATGCTCGAAAAGGTTGTTGCCGGCTTAAATATCCAGGACACGGCATCGACGAATGCA 120


7436R-1.IR_full       121 GCAGGAAACGAGGATGCGGAGCAGCCTGATGGTGCCAAGAATGAGGCTTCAGTGTCTGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     121 GCAGGAAACGAGGATGCGGAGCAGCCTGATGGTGCCAAGAATGAGGCTTCAGTGTCTGCG 180


7436R-1.IR_full       181 AATGCAAGCAAACAGGCCTTGCTACAAGCCGTTTCCGATGCTATGGCCAGTACCCGTCAG 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
7436R-1.in silico     181 AATGCAAGCAAACAGGCCTTGCTACAAGCCGTTTCCGATGCTATGGCCAGCACCCGTCAG 240


7436R-1.IR_full       241 ATGGCCAAGAAGTTTGCATTTTGGTCCACACAGCCAGTCACCAAGCTGGACGAGCAGGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     241 ATGGCCAAGAAGTTTGCATTTTGGTCCACACAGCCAGTCACCAAGCTGGACGAGCAGGTG 300


7436R-1.IR_full       301 ACCACCAACGAATGCATTGAACCGAACAAGGAAATTAGTGAGATTAGAGCATTGCCATAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     301 ACCACCAACGAATGCATTGAACCGAACAAGGAAATTAGTGAGATTAGAGCATTGCCATAC 360


7436R-1.IR_full       361 ACTCTGCCAGGCGGCTTCAAATGGGTGACACTAGACCTGAACGACGCCAATGATCTCAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     361 ACTCTGCCAGGCGGCTTCAAATGGGTGACACTAGACCTGAACGACGCCAATGATCTCAAG 420


7436R-1.IR_full       421 GAGCTGTACACGCTGCTCAATGAGAACTATGTGGAGGACGATGATGCCATGTTCCGTTTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     421 GAGCTGTACACGCTGCTCAATGAGAACTATGTGGAGGACGATGATGCCATGTTCCGTTTC 480


7436R-1.IR_full       481 GATTACCAACCCGAGTTTCTAAAGTGGTCGCTGCAGCCACC 521
                          |||||||||||||||||||||||||||||||||||||||||
7436R-1.in silico     481 GATTACCAACCCGAGTTTCTAAAGTGGTCGCTGCAGCCACC 521

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   503  NM_079245.2  CG7436-RA (Nmt), mRNA 
0.19   NM_135735.1  CG5525-RA (CG5525), mRNA 
0   NM_132360.1  CG9691-RA, transcript variant A (CG9691), mRNA 
0   NM_167206.1  CG9691-RB, transcript variant B (CG9691), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_143284.2  CG6059-RA (CG6059), mRNA 
0   NM_132220.2  CG2263-RA (CG2263), mRNA 
0   NM_132716.1  CG13403-RA (CG13403), mRNA 
0   NM_135559.2  CG5337-RA (CG5337), mRNA 
0   NM_166065.1  CG10149-RA, transcript variant A (Rpn6), mRNA 
0   NM_058126.3  CG10149-RB, transcript variant B (Rpn6), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   NM_133003.2  CG32555-RB, transcript variant B (RhoGAPp190), mRNA 
0   NM_167573.1  CG32555-RC, transcript variant C (RhoGAPp190), mRNA 
0   NM_167572.1  CG32555-RA, transcript variant A (RhoGAPp190), mRNA 
0   NM_164695.1  CG11050-RC, transcript variant C (CG11050), mRNA 
0   NM_164694.1  CG11050-RB, transcript variant B (CG11050), mRNA 
0   NM_135208.4  CG11050-RA, transcript variant A (CG11050), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_134830.1  CG3597-RA (CG3597), mRNA 
0   NM_176537.1  CG33099-RA (CG33099), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.