National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7425R-1 
 Symbol eff  Full Name effete 
 CG No CG7425  Old CG No CG7425 
 Synonyms UbcD1, UBCD1, ubcD1, CG7425, UbcD, UBCD-1, E(Pc)88D, ms(3)ry3, ms(3)ry1, 6535, 3527, SS3-3, Ubc-D1, fs(3)01295, UBC4, ms(3)88D, ms(3)neo2, ms(3)3, ms(3)1, ms(3)01295, mei68, l(3)s1782, l(3)j2C8, l(3)01462, anon-WO0118547.343, eff, Mei-W68 
 Accession No (Link to NCBI) NM_169601.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Pan C, Xiong Y, Lv X, Xia Y, Zhang S, Chen H, Fan J, Wu W, Liu F, Wu H, Zhou Z, Zhang L, Zhao Y.
UbcD1 regulates Hedgehog signaling by directly modulating Ci ubiquitination and processing.
EMBO Rep. (2017) 18(11) 1922-1934 [ PubMed ID = 28887318 ] [ RRC reference ]

Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAAGGAACTGCAAGATCTGGG 
 Primer Seq. 3'
aatctagaggtaccTCTCGTGCCAGCTCATTGTAT 
 Predicted Fragment Size
399 
 IR fragment full Seq
0001 TAAGGAACTG CAAGATCTGG GCAGAGATCC ACCTGCACAA TGTTCAGCCG GTCCAGTTGG 
0061 AGATGATTTA TTTCACTGGC AAGCTACAAT AATGGGCCCG CCGGACAGCC CTTATCAAGG 
0121 AGGTGTATTC TTCTTAACTA TACATTTTCC AACAGACTAT CCCTTTAAAC CACCCAAAGT 
0181 GGCTTTTACA ACGCGCATAT ACCATCCAAA CATCAACAGC AATGGATCGA TTTGTCTCGA 
0241 TATATTAAGA TCTCAGTGGT CGCCAGCATT AACTATTTCA AAAGTTTTAT TATCAATTTG 
0301 CTCTCTACTC TGTGATCCCA ATCCAGACGA TCCTCTTGTT CCAGAGATTG CCAGAATATA 
0361 TAAAACCGAT CGGGAAAAAT ACAATGAGCT GGCACGAGA 
 in silico PCR Fragment
0001 TAAGGAACTG CAAGATCTGG GCAGAGATCC ACCTGCACAA TGTTCAGCCG GTCCAGTTGG 
0061 AGATGATTTA TTTCACTGGC AAGCTACAAT AATGGGCCCG CCGGACAGCC CTTATCAAGG 
0121 AGGTGTATTC TTCTTAACTA TACATTTTCC AACAGACTAT CCCTTTAAAC CACCCAAAGT 
0181 GGCTTTTACA ACGCGCATAT ACCATCCAAA CATCAACAGC AATGGATCGA TTTGTCTCGA 
0241 TATATTAAGA TCTCAGTGGT CGCCAGCATT AACTATTTCA AAAGTTTTAT TATCAATTTG 
0301 CTCTCTACTC TGTGATCCCA ATCCAGACGA TCCTCTTGTT CCAGAGATTG CCAGAATATA 
0361 TAAAACCGAT CGGGAAAAAT ACAATGAGCT GGCACGAGA 
 Assemble Data

7425R-1.IR_full       1   TAAGGAACTGCAAGATCTGGGCAGAGATCCACCTGCACAATGTTCAGCCGGTCCAGTTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     1   TAAGGAACTGCAAGATCTGGGCAGAGATCCACCTGCACAATGTTCAGCCGGTCCAGTTGG 60


7425R-1.IR_full       61  AGATGATTTATTTCACTGGCAAGCTACAATAATGGGCCCGCCGGACAGCCCTTATCAAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     61  AGATGATTTATTTCACTGGCAAGCTACAATAATGGGCCCGCCGGACAGCCCTTATCAAGG 120


7425R-1.IR_full       121 AGGTGTATTCTTCTTAACTATACATTTTCCAACAGACTATCCCTTTAAACCACCCAAAGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     121 AGGTGTATTCTTCTTAACTATACATTTTCCAACAGACTATCCCTTTAAACCACCCAAAGT 180


7425R-1.IR_full       181 GGCTTTTACAACGCGCATATACCATCCAAACATCAACAGCAATGGATCGATTTGTCTCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     181 GGCTTTTACAACGCGCATATACCATCCAAACATCAACAGCAATGGATCGATTTGTCTCGA 240


7425R-1.IR_full       241 TATATTAAGATCTCAGTGGTCGCCAGCATTAACTATTTCAAAAGTTTTATTATCAATTTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     241 TATATTAAGATCTCAGTGGTCGCCAGCATTAACTATTTCAAAAGTTTTATTATCAATTTG 300


7425R-1.IR_full       301 CTCTCTACTCTGTGATCCCAATCCAGACGATCCTCTTGTTCCAGAGATTGCCAGAATATA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     301 CTCTCTACTCTGTGATCCCAATCCAGACGATCCTCTTGTTCCAGAGATTGCCAGAATATA 360


7425R-1.IR_full       361 TAAAACCGATCGGGAAAAATACAATGAGCTGGCACGAGA 399
                          |||||||||||||||||||||||||||||||||||||||
7425R-1.in silico     361 TAAAACCGATCGGGAAAAATACAATGAGCTGGCACGAGA 399

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   381  NM_169601.1  CG7425-RA (eff), mRNA 
0   NM_058066.3  CG5788-RA (UbcD10), mRNA 
0   NM_079963.3  CG7449-RA, transcript variant A (hbs), mRNA 
0   NM_176175.1  CG7449-RB, transcript variant B (hbs), mRNA 
0   NM_141830.2  CG6790-RA (CG6790), mRNA 
0   NM_079882.2  CG1710-RA, transcript variant A (Hcf), mRNA 
0   NM_205873.1  CG1710-RD, transcript variant D (Hcf), mRNA 
0   NM_166756.1  CG1710-RB, transcript variant B (Hcf), mRNA 
0   NM_134750.1  CG5440-RA (CG5440), mRNA 
0   NM_166757.1  CG1710-RC, transcript variant C (Hcf), mRNA 
0   NM_164497.1  CG2903-RA, transcript variant A (Hrs), mRNA 
0   NM_080360.3  CG2903-RB, transcript variant B (Hrs), mRNA 
0   NM_164496.1  CG2903-RC, transcript variant C (Hrs), mRNA 
0   NM_142621.3  CG5077-RA, transcript variant A (CG5077), mRNA 
0   NM_169894.2  CG5077-RD, transcript variant D (CG5077), mRNA 
0   NM_169893.2  CG5077-RC, transcript variant C (CG5077), mRNA 
0   NM_169892.2  CG5077-RB, transcript variant B (CG5077), mRNA 
0   NM_164988.2  CG12317-RB, transcript variant B (JhI-21), mRNA 
0   NM_135698.2  CG12317-RA, transcript variant A (JhI-21), mRNA 
0   NM_135950.2  CG5888-RA (CG5888), mRNA 
0   NM_135422.2  CG17906-RA (CG17906), mRNA 
0   NM_140153.4  CG6449-RA, transcript variant A (NijA), mRNA 
0   NM_057789.3  CG6720-RA, transcript variant A (UbcD2), mRNA 
0   NM_164943.1  CG6720-RB, transcript variant B (UbcD2), mRNA 
0   NM_164379.1  CG31920-RB (CG31920), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0   NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
0   NM_145106.1  CG6964-RA, transcript variant A (Gug), mRNA 
0   NM_079249.2  CG6964-RB, transcript variant B (Gug), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.