National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7420R-2 
 Symbol CG7420  Full Name CG7420 
 CG No CG7420  Old CG No CG7420 
 Synonyms CG7420 
 Accession No (Link to NCBI) NM_134758.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGGTTCGCTTGATTCGTGGAGGTGGTGGCCATGTTCTCATCCTCGACACAAGCGGACGGA 60

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     61  TTCATGCCTGCGGATGGAACAATCGTGGTCAACTGGGACTGGATTCCACGGAGGAGTGCC 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     121 ACAGCGAGTTCAAGATGATCCCCACGGAATACTTCGGGGATGTTCCTGTGGAAACCATTA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGTGGCTGGGACATTTCGGGAGCCATCACGTTGACCAAACGCCTGTTTGTCTGGGGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAATGCCTTTCAGCAGCTGGGAATTTGTCAGCGCGGCTTTACTGCCGTGAGAAGACCAA 300

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     301 TGCCAGTAAAGCTTCCACGCGAAGAACCCGCCCAGAGGATCAGCTTCGGCCTGCGCCACT 360

                          |||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||| silico     361 GTGCCGTCCTTACGCAAGACAACAAAATCTACGTTTTCGGACGATTGAGGATTATGGACC 420

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     421 CTCCGCCCATCGAGCTGGATATC-ACGGCCACCTGCCTGCACCGCTGCAATACGGTGAAG 480

7420R-2.IR_full       481 ATACAGGTCCACAATCCCAAC 501
                          ||||||||||||||||||||| silico     481 ATACAGGTCCACAATCCCAAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134758.2  CG7420-RA (CG7420), mRNA 
0.2   NM_001032400.1  CG9850-RB, transcript variant B (CG9850), mRNA 
0.2   NM_137983.3  CG9850-RA, transcript variant A (CG9850), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   NM_143705.2  CG12225-RA (Spt6), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_057324.3  CG5109-RA (Pcl), mRNA 
0   NM_170406.1  CG11956-RC, transcript variant C (SP1029), mRNA 
0   NM_144361.1  CG11956-RA, transcript variant A (SP1029), mRNA 
0   NM_170405.1  CG11956-RB, transcript variant B (SP1029), mRNA 
0   NM_136138.2  CG10165-RA, transcript variant A (CG10165), mRNA 
0   NM_165309.1  CG10165-RB, transcript variant B (CG10165), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_134565.1  CG15450-RA (CG15450), mRNA 
0   NM_136484.1  CG12820-RA (CG12820), mRNA 
0   NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_167377.1  CG11178-RA, transcript variant A (CG11178), mRNA 
0   NM_132673.2  CG11178-RB, transcript variant B (CG11178), mRNA 
0   NM_001014538.1  CG10737-RE, transcript variant E (CG10737), mRNA 
0   NM_166333.1  CG10737-RD, transcript variant D (CG10737), mRNA 
0   NM_166334.1  CG10737-RA, transcript variant A (CG10737), mRNA 
0   NM_166332.1  CG10737-RB, transcript variant B (CG10737), mRNA 
0   NM_137554.2  CG10737-RC, transcript variant C (CG10737), mRNA 
0   NM_079755.1  CG6331-RA (Orct), mRNA 
0   NM_136089.2  CG17492-RA (mib2), mRNA 
0   NM_136993.2  CG3955-RA (CG3955), mRNA 
0   NM_143476.2  CG7802-RA, transcript variant A (CG7802), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.