National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7420R-1 
 Symbol CG7420  Full Name CG7420 
 CG No CG7420  Old CG No CG7420 
 Synonyms CG7420 
 Accession No (Link to NCBI) NM_134758.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGTTCGCTTGATTCGTGGAG 
 Primer Seq. 3'
aatctagaggtaccGTTGGGATTGTGGACCTGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGTTCGCTT GATTCGTGGA GGTGGTGGCC ATGTTCTCAT CCTCGACACA AGCGGACGGA 
0061 TTCATGCCTG CGGATGGAAC AATCGTGGCC AACTGGGACT GGATTCCACG GAGGAGTGCC 
0121 ACAGCGAGTT CAAGATGATC CCCACGGAAT ACTTCGGGGA TGTTCCTGTG GAAACAATTA 
0181 GCTGTGGCTG GGACATTTCG GGAGCCATCA CGTTGACCAA ACGCCTGTTT GTCTGGGGCT 
0241 CCAATGCCTT TCAGCAGCTG GGAATTTGTC AGCGCGGCTT TACTGCCGTG AGAAGACCAA 
0301 TGCCAGTAAA GCTTCCACGC GAAGAACCCG CCCAGAGGAT TAGCTTCGGC CTGCGCCACT 
0361 GTGCCGTCCT TACGCAAGAC AACAAAATCT ACGTCTTCGG ACGACTGAGG ATCATGGACC 
0421 CTCCGCCCAT CGAGCTGGAT ATCNACGGCC ACCTGCCTGC ACCGCTGCAA TACGGTGAAG 
0481 ATACAGGTCC ACAATCCCAA C 
 in silico PCR Fragment
0001 AGGTTCGCTT GATTCGTGGA GGTGGTGGCC ATGTTCTCAT CCTCGACACA AGCGGACGGA 
0061 TTCATGCCTG CGGATGGAAC AATCGTGGTC AACTGGGACT GGATTCCACG GAGGAGTGCC 
0121 ACAGCGAGTT CAAGATGATC CCCACGGAAT ACTTCGGGGA TGTTCCTGTG GAAACCATTA 
0181 GCTGTGGCTG GGACATTTCG GGAGCCATCA CGTTGACCAA ACGCCTGTTT GTCTGGGGCT 
0241 CCAATGCCTT TCAGCAGCTG GGAATTTGTC AGCGCGGCTT TACTGCCGTG AGAAGACCAA 
0301 TGCCAGTAAA GCTTCCACGC GAAGAACCCG CCCAGAGGAT CAGCTTCGGC CTGCGCCACT 
0361 GTGCCGTCCT TACGCAAGAC AACAAAATCT ACGTTTTCGG ACGATTGAGG ATTATGGACC 
0421 CTCCGCCCAT CGAGCTGGAT ATC-ACGGCC ACCTGCCTGC ACCGCTGCAA TACGGTGAAG 
0481 ATACAGGTCC ACAATCCCAA C 
 Assemble Data

7420R-1.IR_full       1   AGGTTCGCTTGATTCGTGGAGGTGGTGGCCATGTTCTCATCCTCGACACAAGCGGACGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7420R-1.in silico     1   AGGTTCGCTTGATTCGTGGAGGTGGTGGCCATGTTCTCATCCTCGACACAAGCGGACGGA 60


7420R-1.IR_full       61  TTCATGCCTGCGGATGGAACAATCGTGGCCAACTGGGACTGGATTCCACGGAGGAGTGCC 120
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
7420R-1.in silico     61  TTCATGCCTGCGGATGGAACAATCGTGGTCAACTGGGACTGGATTCCACGGAGGAGTGCC 120


7420R-1.IR_full       121 ACAGCGAGTTCAAGATGATCCCCACGGAATACTTCGGGGATGTTCCTGTGGAAACAATTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
7420R-1.in silico     121 ACAGCGAGTTCAAGATGATCCCCACGGAATACTTCGGGGATGTTCCTGTGGAAACCATTA 180


7420R-1.IR_full       181 GCTGTGGCTGGGACATTTCGGGAGCCATCACGTTGACCAAACGCCTGTTTGTCTGGGGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7420R-1.in silico     181 GCTGTGGCTGGGACATTTCGGGAGCCATCACGTTGACCAAACGCCTGTTTGTCTGGGGCT 240


7420R-1.IR_full       241 CCAATGCCTTTCAGCAGCTGGGAATTTGTCAGCGCGGCTTTACTGCCGTGAGAAGACCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7420R-1.in silico     241 CCAATGCCTTTCAGCAGCTGGGAATTTGTCAGCGCGGCTTTACTGCCGTGAGAAGACCAA 300


7420R-1.IR_full       301 TGCCAGTAAAGCTTCCACGCGAAGAACCCGCCCAGAGGATTAGCTTCGGCCTGCGCCACT 360
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
7420R-1.in silico     301 TGCCAGTAAAGCTTCCACGCGAAGAACCCGCCCAGAGGATCAGCTTCGGCCTGCGCCACT 360


7420R-1.IR_full       361 GTGCCGTCCTTACGCAAGACAACAAAATCTACGTCTTCGGACGACTGAGGATCATGGACC 420
                          |||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||
7420R-1.in silico     361 GTGCCGTCCTTACGCAAGACAACAAAATCTACGTTTTCGGACGATTGAGGATTATGGACC 420


7420R-1.IR_full       421 CTCCGCCCATCGAGCTGGATATCNACGGCCACCTGCCTGCACCGCTGCAATACGGTGAAG 480
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
7420R-1.in silico     421 CTCCGCCCATCGAGCTGGATATC-ACGGCCACCTGCCTGCACCGCTGCAATACGGTGAAG 480


7420R-1.IR_full       481 ATACAGGTCCACAATCCCAAC 501
                          |||||||||||||||||||||
7420R-1.in silico     481 ATACAGGTCCACAATCCCAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.