National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7420R-1 
 Symbol CG7420  Full Name CG7420 
 CG No CG7420  Old CG No CG7420 
 Synonyms CG7420 
 Accession No (Link to NCBI) NM_134758.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGGTTCGCTTGATTCGTGGAGGTGGTGGCCATGTTCTCATCCTCGACACAAGCGGACGGA 60

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     61  TTCATGCCTGCGGATGGAACAATCGTGGTCAACTGGGACTGGATTCCACGGAGGAGTGCC 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     121 ACAGCGAGTTCAAGATGATCCCCACGGAATACTTCGGGGATGTTCCTGTGGAAACCATTA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGTGGCTGGGACATTTCGGGAGCCATCACGTTGACCAAACGCCTGTTTGTCTGGGGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAATGCCTTTCAGCAGCTGGGAATTTGTCAGCGCGGCTTTACTGCCGTGAGAAGACCAA 300

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     301 TGCCAGTAAAGCTTCCACGCGAAGAACCCGCCCAGAGGATCAGCTTCGGCCTGCGCCACT 360

                          |||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||| silico     361 GTGCCGTCCTTACGCAAGACAACAAAATCTACGTTTTCGGACGATTGAGGATTATGGACC 420

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     421 CTCCGCCCATCGAGCTGGATATC-ACGGCCACCTGCCTGCACCGCTGCAATACGGTGAAG 480

7420R-1.IR_full       481 ATACAGGTCCACAATCCCAAC 501
                          ||||||||||||||||||||| silico     481 ATACAGGTCCACAATCCCAAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.