National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7398R-1 
 Symbol Trn  Full Name Transportin 
 CG No CG7398  Old CG No CG7398 
 Synonyms dTRN, Trn1, CG7398, Tm, TRN, Trn, IMPbeta2 
 Accession No (Link to NCBI) NM_058020.3 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTGGGAACCACAGGGAGAAG 
 Primer Seq. 3'
aatctagaggtaccCCTGTTGAGCGCTGCGGAATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTGGGANAC CACAGGGAGA AGGTCTGCAG CAGATCATAG CGATCCTCAA GGAGTCGCAG 
0061 TCACCGGACA CAGCCACTCA AATGGCCGTA CAGATGAAAC TGGAGGAATT CAATCGCTAC 
0121 CCCGACTTCA ACAACTATCT TATCTATGTG CTGACGAAAC TGAAGACAGA GGACGAGCCC 
0181 ACGAGATCAC TCAGCGGCCT AATCCTCAAG AACAACATCC GCATGCACGG CACCACTCTG 
0241 CAGCCGGAGA TCGTGGAGTA TATCAAACAC GAGTGCCTGC AGGCAGTGGG CGACGCTTCG 
0301 CCCCTGATCC GTGCCACCGT GGGCATCCTG ATTACCACCA TCGCCAGCAA TGGCGGTCNT 
0361 GCACAACTGG CCGCAGCTGC TTCCATCTCT CTGCGAAATG CTCGACAACC AGGACTATAA 
0421 TGTGTGCGAA GGCGCATTCA GTGCCCTGCA GAAAATTTGC GAGGACTCTG CCGAGATTTT 
0481 GGATTCCGCA GCGCTCAACA GG 
 in silico PCR Fragment
0001 CGTGGGA-AC CACAGGGAGA AGGTCTGCAG CAGATCATAG CGATCCTCAA GGAGTCGCAG 
0061 TCACCGGACA CAGCCACTCA AATGGCCGTA CAGATGAAAC TGGAGGAATT CAATCGCTAC 
0121 CCCGACTTCA ACAACTATCT TATCTATGTG CTGACGAAAC TGAAGACAGA GGACGAGCCC 
0181 ACGAGATCAC TCAGCGGCCT AATCCTCAAG AACAACATCC GCATGCACGG CACCACTCTG 
0241 CAGCCGGAGA TCGTGGAGTA TATCAAACAC GAGTGCCTGC AGGCAGTGGG CGACGCTTCG 
0301 CCCCTGATCC GTGCCACCGT GGGCATCCTG ATTACCACCA TCGCCAGCAA TGGCGGTC-T 
0361 GCACAACTGG CCGCAGCTGC TTCCATCTCT CTGCGAAATG CTCGACAACC AGGACTATAA 
0421 TGTGTGCGAA GGCGCATTCA GTGCCCTGCA GAAAATTTGC GAGGACTCTG CCGAGATTTT 
0481 GGATTCCGCA GCGCTCAACA GG 
 Assemble Data

7398R-1.IR_full       1   CGTGGGANACCACAGGGAGAAGGTCTGCAGCAGATCATAGCGATCCTCAAGGAGTCGCAG 60
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     1   CGTGGGA-ACCACAGGGAGAAGGTCTGCAGCAGATCATAGCGATCCTCAAGGAGTCGCAG 60


7398R-1.IR_full       61  TCACCGGACACAGCCACTCAAATGGCCGTACAGATGAAACTGGAGGAATTCAATCGCTAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     61  TCACCGGACACAGCCACTCAAATGGCCGTACAGATGAAACTGGAGGAATTCAATCGCTAC 120


7398R-1.IR_full       121 CCCGACTTCAACAACTATCTTATCTATGTGCTGACGAAACTGAAGACAGAGGACGAGCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     121 CCCGACTTCAACAACTATCTTATCTATGTGCTGACGAAACTGAAGACAGAGGACGAGCCC 180


7398R-1.IR_full       181 ACGAGATCACTCAGCGGCCTAATCCTCAAGAACAACATCCGCATGCACGGCACCACTCTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     181 ACGAGATCACTCAGCGGCCTAATCCTCAAGAACAACATCCGCATGCACGGCACCACTCTG 240


7398R-1.IR_full       241 CAGCCGGAGATCGTGGAGTATATCAAACACGAGTGCCTGCAGGCAGTGGGCGACGCTTCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     241 CAGCCGGAGATCGTGGAGTATATCAAACACGAGTGCCTGCAGGCAGTGGGCGACGCTTCG 300


7398R-1.IR_full       301 CCCCTGATCCGTGCCACCGTGGGCATCCTGATTACCACCATCGCCAGCAATGGCGGTCNT 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
7398R-1.in silico     301 CCCCTGATCCGTGCCACCGTGGGCATCCTGATTACCACCATCGCCAGCAATGGCGGTC-T 360


7398R-1.IR_full       361 GCACAACTGGCCGCAGCTGCTTCCATCTCTCTGCGAAATGCTCGACAACCAGGACTATAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     361 GCACAACTGGCCGCAGCTGCTTCCATCTCTCTGCGAAATGCTCGACAACCAGGACTATAA 420


7398R-1.IR_full       421 TGTGTGCGAAGGCGCATTCAGTGCCCTGCAGAAAATTTGCGAGGACTCTGCCGAGATTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7398R-1.in silico     421 TGTGTGCGAAGGCGCATTCAGTGCCCTGCAGAAAATTTGCGAGGACTCTGCCGAGATTTT 480


7398R-1.IR_full       481 GGATTCCGCAGCGCTCAACAGG 502
                          ||||||||||||||||||||||
7398R-1.in silico     481 GGATTCCGCAGCGCTCAACAGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058020.3  CG7398-RA, transcript variant A (Trn), mRNA 
100   482  NM_168160.1  CG7398-RB, transcript variant B (Trn), mRNA 
100   482  NM_168161.1  CG7398-RC, transcript variant C (Trn), mRNA 
14.1   68  92  69  51  NM_139781.1  CG8219-RA (CG8219), mRNA 
0   NM_136974.2  CG12373-RA (mRpL18), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_165693.2  CG30004-RA (CG30004), mRNA 
0   NM_140324.2  CG10646-RA (CG10646), mRNA 
0   NM_130646.2  CG14045-RA (CG14045), mRNA 
0   NM_140188.2  CG6210-RA, transcript variant A (srt), mRNA 
0   NM_168450.1  CG6210-RB, transcript variant B (srt), mRNA 
0   NM_137728.2  CG30392-RA (CG30392), mRNA 
0   NM_143765.2  CG12218-RA (mei-P26), mRNA 
0   NM_139783.1  CG10226-RA (CG10226), mRNA 
0   NM_057233.3  CG10160-RA (ImpL3), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_206105.1  CG17054-RB, transcript variant B (Cap-G), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_140863.1  CG9283-RA (CG9283), mRNA 
0   NM_140321.1  CG10660-RA (CG10660), mRNA 
0   NM_079058.2  CG5186-RA, transcript variant A (slim), mRNA 
0   NM_143286.1  CG5896-RB, transcript variant B (CG5896), mRNA 
0   NM_170318.1  CG5896-RA, transcript variant A (CG5896), mRNA 
0   NM_166289.1  CG5186-RB, transcript variant B (slim), mRNA 
0   NM_132202.2  CG15330-RA (CG15330), mRNA 
0   17  NM_175960.3  CG33196-RB (dp), mRNA 
0   11  NM_164354.1  CG31973-RB, transcript variant B (CG31973), mRNA 
0   NM_132587.2  CG11085-RA (CG11085), mRNA 
0   11  NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   11  NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.