National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7395R-3 
 Symbol NPFR76F  Full Name Neuropeptide F-like Receptor 76F 
 CG No CG7395  Old CG No CG7395 
 Synonyms CT22771, GPCR60, CG7395, Drm-sNPF-R, CG7395/CG18639, CG18639, anon-WO0131005.1, NPFR76F 
 Accession No (Link to NCBI) NM_079452.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTCCTCCTCCATCAGCACCAGCCAGCTGCCATTGGTCAGCACAACCAACTGGAGCCTAAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCGCCGGGAACTACTAGCGCTATCTTGGCGGATGTGGCTGCATCGGATGAGGATAGGAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCGGGATCATTCACAACCAGTTCGTGCAAATCTTCTTCTACGTCCTGTACGCCACGGT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTTTGTCCTGGGTGTCTTCGGAAATGTCCTGGTTTGCTACGTAGTTCTGAGGAATCGGGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATGCAGACTGTGACCAATATATTCATCACGAATCTGGCCCTGTCGGACATATTGCTCTG 300

                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| silico     301 CGTCCTGGCGGTGCCATTTACTCCGCTTTACACGTTCATGGGTCG-CTGGGCCTTCGGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGAGTCTGTGCCATCTGGTGTCCTTTGCCCAGGGATGCAGCATCTACATATCCACGCTGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCTCACCTCGATTGCCATCGATCGGTACTTCGTTATCATATACCCCTTCCATCCGCGCA 480

7395R-3.IR_full       481 TGAAGCTCTCCACCTGCATCG 501
                          ||||||||||||||||||||| silico     481 TGAAGCTCTCCACCTGCATCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079452.2  CG7395-RA (NPFR76F), mRNA 
0   NM_144305.2  CG18661-RA (CG18661), mRNA 
0   NM_132189.1  CG1422-RA (p115), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165731.1  CG2264-RC, transcript variant C (CG2264), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_165730.1  CG2264-RA, transcript variant A (CG2264), mRNA 
0   NM_136705.1  CG2292-RA (CG2292), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
0   NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
0   NM_165996.1  CG6033-RD, transcript variant D (drk), mRNA 
0   NM_165995.1  CG6033-RC, transcript variant C (drk), mRNA 
0   NM_165994.1  CG6033-RB, transcript variant B (drk), mRNA 
0   NM_165997.1  CG6033-RE, transcript variant E (drk), mRNA 
0   NM_165998.1  CG6033-RF, transcript variant F (drk), mRNA 
0   NM_057510.3  CG6033-RA, transcript variant A (drk), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_130586.1  CG14811-RA (CG14811), mRNA 
0   NM_137800.1  CG11269-RA (CG11269), mRNA 
0   NM_078932.2  CG17853-RA (Or43b), mRNA 
0   NM_079674.2  CG16740-RA (Rh2), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_142123.1  CG3505-RA (CG3505), mRNA 
0   NM_140690.2  CG7729-RA (Fit2), mRNA 
0   NM_143535.1  CG15534-RA (CG15534), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.