National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7395R-2 
 Symbol NPFR76F  Full Name Neuropeptide F-like Receptor 76F 
 CG No CG7395  Old CG No CG7395 
 Synonyms CT22771, GPCR60, CG7395, Drm-sNPF-R, CG7395/CG18639, CG18639, anon-WO0131005.1, NPFR76F 
 Accession No (Link to NCBI) NM_079452.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCTCCTCCATCAGCACCAG 
 Primer Seq. 3'
aatctagaggtaccCGATGCAGGTGGAGAGCTTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCTCCTCC ATCAGCACCA GCCAGCTGCC ATTGGTCAGC ACAACCAACT GGAGCCTAAC 
0061 GTCGCCGGGA ACTACTAGCG CTATCTTGGC GGATGTGGCT GCATCGGATG AGGATAGGAG 
0121 CGGCGGGATC ATTCACAACC AGTTCGTGCA AATCTTCTTC TACGTCCTGT ACGCCACGGT 
0181 CTTTGTCCTG GGTGTCTTCG GAAATGTCCT GGTTTGCTAC GTAGTTCTGA GGAATCGGGC 
0241 CATGCAGACT GTGACCAATA TATTCATCAC GAATCTGGCC CTGTCGGACA TATTGCTCTG 
0301 CGTCCTGGCG GTGCCATTTA CTCCGCTTTA CACGTTCATG GGTCGNCTGg gcCNTCGGCA 
0361 GGAGTCTGTG CCATCTGGTG TCCTTTGCCC AGGGATGCAG CATCTACATA TCCACGCTGA 
0421 CCCTCACCTC GATTGCCATC GATCGGTACT TCGTTATCAT ATACCCCTTC CATCCGCGCA 
0481 TGAAGCTCTC CACCTGCATC G 
 in silico PCR Fragment
0001 CTCCTCCTCC ATCAGCACCA GCCAGCTGCC ATTGGTCAGC ACAACCAACT GGAGCCTAAC 
0061 GTCGCCGGGA ACTACTAGCG CTATCTTGGC GGATGTGGCT GCATCGGATG AGGATAGGAG 
0121 CGGCGGGATC ATTCACAACC AGTTCGTGCA AATCTTCTTC TACGTCCTGT ACGCCACGGT 
0181 CTTTGTCCTG GGTGTCTTCG GAAATGTCCT GGTTTGCTAC GTAGTTCTGA GGAATCGGGC 
0241 CATGCAGACT GTGACCAATA TATTCATCAC GAATCTGGCC CTGTCGGACA TATTGCTCTG 
0301 CGTCCTGGCG GTGCCATTTA CTCCGCTTTA CACGTTCATG GGTCG-CTGG GCCTTCGGCA 
0361 GGAGTCTGTG CCATCTGGTG TCCTTTGCCC AGGGATGCAG CATCTACATA TCCACGCTGA 
0421 CCCTCACCTC GATTGCCATC GATCGGTACT TCGTTATCAT ATACCCCTTC CATCCGCGCA 
0481 TGAAGCTCTC CACCTGCATC G 
 Assemble Data

7395R-2.IR_full       1   CTCCTCCTCCATCAGCACCAGCCAGCTGCCATTGGTCAGCACAACCAACTGGAGCCTAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     1   CTCCTCCTCCATCAGCACCAGCCAGCTGCCATTGGTCAGCACAACCAACTGGAGCCTAAC 60


7395R-2.IR_full       61  GTCGCCGGGAACTACTAGCGCTATCTTGGCGGATGTGGCTGCATCGGATGAGGATAGGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     61  GTCGCCGGGAACTACTAGCGCTATCTTGGCGGATGTGGCTGCATCGGATGAGGATAGGAG 120


7395R-2.IR_full       121 CGGCGGGATCATTCACAACCAGTTCGTGCAAATCTTCTTCTACGTCCTGTACGCCACGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     121 CGGCGGGATCATTCACAACCAGTTCGTGCAAATCTTCTTCTACGTCCTGTACGCCACGGT 180


7395R-2.IR_full       181 CTTTGTCCTGGGTGTCTTCGGAAATGTCCTGGTTTGCTACGTAGTTCTGAGGAATCGGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     181 CTTTGTCCTGGGTGTCTTCGGAAATGTCCTGGTTTGCTACGTAGTTCTGAGGAATCGGGC 240


7395R-2.IR_full       241 CATGCAGACTGTGACCAATATATTCATCACGAATCTGGCCCTGTCGGACATATTGCTCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     241 CATGCAGACTGTGACCAATATATTCATCACGAATCTGGCCCTGTCGGACATATTGCTCTG 300


7395R-2.IR_full       301 CGTCCTGGCGGTGCCATTTACTCCGCTTTACACGTTCATGGGTCGNCTGGGCCNTCGGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||
7395R-2.in silico     301 CGTCCTGGCGGTGCCATTTACTCCGCTTTACACGTTCATGGGTCG-CTGGGCCTTCGGCA 360


7395R-2.IR_full       361 GGAGTCTGTGCCATCTGGTGTCCTTTGCCCAGGGATGCAGCATCTACATATCCACGCTGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     361 GGAGTCTGTGCCATCTGGTGTCCTTTGCCCAGGGATGCAGCATCTACATATCCACGCTGA 420


7395R-2.IR_full       421 CCCTCACCTCGATTGCCATCGATCGGTACTTCGTTATCATATACCCCTTCCATCCGCGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7395R-2.in silico     421 CCCTCACCTCGATTGCCATCGATCGGTACTTCGTTATCATATACCCCTTCCATCCGCGCA 480


7395R-2.IR_full       481 TGAAGCTCTCCACCTGCATCG 501
                          |||||||||||||||||||||
7395R-2.in silico     481 TGAAGCTCTCCACCTGCATCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079452.2  CG7395-RA (NPFR76F), mRNA 
0   NM_144305.2  CG18661-RA (CG18661), mRNA 
0   NM_132189.1  CG1422-RA (p115), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165731.1  CG2264-RC, transcript variant C (CG2264), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_165730.1  CG2264-RA, transcript variant A (CG2264), mRNA 
0   NM_136705.1  CG2292-RA (CG2292), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
0   NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
0   NM_165996.1  CG6033-RD, transcript variant D (drk), mRNA 
0   NM_165995.1  CG6033-RC, transcript variant C (drk), mRNA 
0   NM_165994.1  CG6033-RB, transcript variant B (drk), mRNA 
0   NM_165997.1  CG6033-RE, transcript variant E (drk), mRNA 
0   NM_165998.1  CG6033-RF, transcript variant F (drk), mRNA 
0   NM_057510.3  CG6033-RA, transcript variant A (drk), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_130586.1  CG14811-RA (CG14811), mRNA 
0   NM_137800.1  CG11269-RA (CG11269), mRNA 
0   NM_078932.2  CG17853-RA (Or43b), mRNA 
0   NM_079674.2  CG16740-RA (Rh2), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_142123.1  CG3505-RA (CG3505), mRNA 
0   NM_140690.2  CG7729-RA (Fit2), mRNA 
0   NM_143535.1  CG15534-RA (CG15534), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.