National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7393R-3 
 Symbol p38b  Full Name p38b 
 CG No CG7393  Old CG No CG7393 
 Synonyms p38b, p38beta, p38, Dp38, D-p38, D-p38b, p38 beta, p38B, CG7393, p38 MAPK, BG:DS00797.3, 186F5S, anon-sts23, Mpk34C, ESTS:186F5S, Dm p38b 
 Accession No (Link to NCBI) NM_058013.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Clemente-Ruiz M, Murillo-Maldonado JM, Benhra N, Barrio L, Pérez L, Quiroga G, Nebreda AR, Milán M.
Gene Dosage Imbalance Contributes to Chromosomal Instability-Induced Tumorigenesis.
Dev. Cell (2016) 36(3) 290-302 [ PubMed ID = 26859353 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCAAATTCTACAAGCTGGAC 
 Primer Seq. 3'
aatctagaggtaccAAATCCAGGATGCGAAGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCAAATTCT ACAAGCTGGA CATCAATCGC ACCGAGTGGG AAATCCCGGA AACATACCAG 
0061 AACCTGCAAC CCGTGGGTCA GGGTGCCTAC GgcCAGGTCT GCAAGGCCGT GGTCCGCGGA 
0121 ACCAGCACGA AGGTGGCCAT CAAGAAGCTT GCCAGGCCCT TCCAGTCGGC GGTCCATGCG 
0181 aAGCgNACCT ATCGGGAACT GCGGCTGNTG AAGCACATGG ATCACGAGAA CGTTATTGGT 
0241 CTGCTGGATG TCTTTCATCC AGGACAGCCC GCCGATTCGC TGGATCAGTT CCAGCAAGTG 
0301 TACATGGTGA CCCACTTGAT GGACGCCGAT CTGAACAACA TAATACGCAC GCAGAAACTG 
0361 TCTGATGATC ATGTCCAGTT TCTGGTCTAC CAAATCCTGC GCGGTCTGNN NTACATCCAC 
0421 AGCGCTGGGG TCATCCATCG TGATCTAAAG CCATCGAACA TTGCGGTAAA CGAGGANCTg 
0481 tgaGCTTCGC aTCCTGGGAT TT 
 in silico PCR Fragment
0001 GCCAAATTCT ACAAGCTGGA CATCAATCGC ACCGAGTGGG AAATCCCGGA AACATACCAG 
0061 AACCTGCAAC CCGTGGGTCA GGGTGCCTAC GGCCAGGTCT GCAAGGCCGT GGTCCGCGGA 
0121 ACCAGCACGA AGGTGGCCAT CAAGAAGCTT GCCAGGCCCT TCCAGTCGGC GGTCCATGCG 
0181 AAGCGCACCT ATCGGGAACT GCGGCTGCTG AAGCACATGG ATCACGAGAA CGTTATTGGT 
0241 CTGCTGGATG TCTTTCATCC AGGACAGCCC GCCGATTCGC TGGATCAGTT CCAGCAAGTG 
0301 TACATGGTGA CCCACTTGAT GGACGCCGAT CTGAACAACA TAATACGCAC GCAGAAACTG 
0361 TCTGATGATC ATGTCCAGTT TCTGGTCTAC CAAATCCTGC GCGGTCTGAA GTACATCCAC 
0421 AGCGCTGGGG TCATCCATCG TGATCTAAAG CCATCGAACA TTGCGGTAAA CGAGGA-CTG 
0481 TGAGCTTCGC ATCCT-GGAT TT 
 Assemble Data

7393R-3.IR_full       1   GCCAAATTCTACAAGCTGGACATCAATCGCACCGAGTGGGAAATCCCGGAAACATACCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7393R-3.in silico     1   GCCAAATTCTACAAGCTGGACATCAATCGCACCGAGTGGGAAATCCCGGAAACATACCAG 60


7393R-3.IR_full       61  AACCTGCAACCCGTGGGTCAGGGTGCCTACGGCCAGGTCTGCAAGGCCGTGGTCCGCGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7393R-3.in silico     61  AACCTGCAACCCGTGGGTCAGGGTGCCTACGGCCAGGTCTGCAAGGCCGTGGTCCGCGGA 120


7393R-3.IR_full       121 ACCAGCACGAAGGTGGCCATCAAGAAGCTTGCCAGGCCCTTCCAGTCGGCGGTCCATGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7393R-3.in silico     121 ACCAGCACGAAGGTGGCCATCAAGAAGCTTGCCAGGCCCTTCCAGTCGGCGGTCCATGCG 180


7393R-3.IR_full       181 AAGCGNACCTATCGGGAACTGCGGCTGNTGAAGCACATGGATCACGAGAACGTTATTGGT 240
                          ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||
7393R-3.in silico     181 AAGCGCACCTATCGGGAACTGCGGCTGCTGAAGCACATGGATCACGAGAACGTTATTGGT 240


7393R-3.IR_full       241 CTGCTGGATGTCTTTCATCCAGGACAGCCCGCCGATTCGCTGGATCAGTTCCAGCAAGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7393R-3.in silico     241 CTGCTGGATGTCTTTCATCCAGGACAGCCCGCCGATTCGCTGGATCAGTTCCAGCAAGTG 300


7393R-3.IR_full       301 TACATGGTGACCCACTTGATGGACGCCGATCTGAACAACATAATACGCACGCAGAAACTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7393R-3.in silico     301 TACATGGTGACCCACTTGATGGACGCCGATCTGAACAACATAATACGCACGCAGAAACTG 360


7393R-3.IR_full       361 TCTGATGATCATGTCCAGTTTCTGGTCTACCAAATCCTGCGCGGTCTGNNNTACATCCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||
7393R-3.in silico     361 TCTGATGATCATGTCCAGTTTCTGGTCTACCAAATCCTGCGCGGTCTGAAGTACATCCAC 420


7393R-3.IR_full       421 AGCGCTGGGGTCATCCATCGTGATCTAAAGCCATCGAACATTGCGGTAAACGAGGANCTG 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
7393R-3.in silico     421 AGCGCTGGGGTCATCCATCGTGATCTAAAGCCATCGAACATTGCGGTAAACGAGGA-CTG 480


7393R-3.IR_full       481 TGAGCTTCGCATCCTGGGATTT 502
                          ||||||||||||||| ||||||
7393R-3.in silico     481 TGAGCTTCGCATCCT-GGATTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058013.3  CG7393-RA (p38b), mRNA 
0.2   NM_137810.1  CG3290-RA (CG3290), mRNA 
0   21  48  95  NM_170126.2  CG5475-RB, transcript variant B (Mpk2), mRNA 
0   21  48  95  NM_057815.3  CG5475-RA, transcript variant A (Mpk2), mRNA 
0   12  34  NM_206554.1  CG33338-RA (p38c), mRNA 
0   NM_142727.1  CG6800-RA (CG6800), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_166760.1  CG1495-RB, transcript variant B (CaMKI), mRNA 
0   NM_166761.1  CG1495-RC, transcript variant C (CaMKI), mRNA 
0   NM_166759.1  CG1495-RA, transcript variant A (CaMKI), mRNA 
0   NM_166762.1  CG1495-RE, transcript variant E (CaMKI), mRNA 
0   NM_079883.2  CG1495-RG, transcript variant G (CaMKI), mRNA 
0   NM_166764.1  CG1495-RH, transcript variant H (CaMKI), mRNA 
0   NM_166763.1  CG1495-RD, transcript variant D (CaMKI), mRNA 
0   11  NM_166415.1  CG3216-RB, transcript variant B (CG3216), mRNA 
0   11  NM_137688.1  CG3216-RA, transcript variant A (CG3216), mRNA 
0   NM_165298.1  CG10237-RC, transcript variant C (CG10237), mRNA 
0   NM_136123.2  CG10237-RB, transcript variant B (CG10237), mRNA 
0   NM_165299.1  CG10237-RA, transcript variant A (CG10237), mRNA 
0   NM_167082.2  CG4095-RA (CG4095), mRNA 
0   15  NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_137811.2  CG3264-RA (CG3264), mRNA 
0   NM_134904.2  CG3523-RA (CG3523), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NR_002550.1  CR33655, miscRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.