National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7381R-3 
 Symbol CG7381  Full Name CG7381 
 CG No CG7381  Old CG No CG7381 
 Synonyms CT22687, CG7381 
 Accession No (Link to NCBI) NM_141985.1 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCGTA-TTTTGGCCATGTGAAACCGAGGCGGACTGCACAGCTGACGGTACTAGCTGCGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTTTGCCAGCGGCCAGTGCGAGTGCTCCACATTCGATACGGTGCTCGCGGAGAACTTCAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAATGCCTGGCCACGTCGCTCATTGGTGAAAAGTGCGACGACAGCGTCCAGTGCAATCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TATGCCAACGGGGGCCAGTTGTAAAGCCGGGGTCTGCGATTGCGCCGATGGCCAGAACTA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCTGCGTGGCAAGTGTCGCCCACTGAACGGACTCGGCGAGTCCTGCGAAACGGACTTGGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGCTACTTTGGCTACGATCGTGCGTCTGTAAGTTGTCAGCAAAACGTGTGCGGCTGTGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAATGGCTATTATAACAGATATGGAAACATCTGCCGTCGCAAATCAATGGAAGAAAACGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCCTGCGTCGTTAACGCGGACTGTGATGAACTGGGCGCCGGTGTCGAGTGCGTTGGCCT 480

7381R-3.IR_full       481 AGTATGCACCTATGTGGACGA 501
                          ||||||||||||||||||||| silico     481 AGTATGCACCTATGTGGACGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169485.1  CG7381-RB, transcript variant B (CG7381), mRNA 
100   482  NM_141985.1  CG7381-RA, transcript variant A (CG7381), mRNA 
39.62   191  NM_169486.1  CG7381-RC, transcript variant C (CG7381), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_168788.2  CG9655-RB, transcript variant B (nes), mRNA 
0   NM_176349.1  CG9655-RC, transcript variant C (nes), mRNA 
0   NM_079433.2  CG9655-RA, transcript variant A (nes), mRNA 
0   NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   NM_057559.3  CG3656-RA, transcript variant A (Cyp4d1), mRNA 
0   NM_170236.1  CG31096-RA (Lgr3), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   13  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   13  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   13  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_134294.1  CG10334-RC, transcript variant C (spi), mRNA 
0   NM_134295.1  CG10334-RD, transcript variant D (spi), mRNA 
0   NM_134293.2  CG10334-RB, transcript variant B (spi), mRNA 
0   NM_057561.4  CG10334-RF, transcript variant F (spi), mRNA 
0   NM_134292.2  CG10334-RE, transcript variant E (spi), mRNA 
0   NM_001032110.1  CG10334-RG, transcript variant G (spi), mRNA 
0   NM_134291.3  CG10334-RA, transcript variant A (spi), mRNA 
0   NM_078831.1  CG5006-RA (Or33c), mRNA 
0   NM_135814.1  CG16850-RA (CG16850), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.