National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7381R-1 
 Symbol CG7381  Full Name CG7381 
 CG No CG7381  Old CG No CG7381 
 Synonyms CT22687, CG7381 
 Accession No (Link to NCBI) NM_141985.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGTATTTTGGCCATGTGAA 
 Primer Seq. 3'
aatctagaggtaccTCGTCCACATAGGTGCATACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGTANTTT TGGCCATGTG AAACCGAGGC GGACTGCACA GCTGACGGTA CTAGCTGCGA 
0061 TTTTGCCAGC GGCCAGTGCG AGTGCTCCAC ATTCGATACG GTGCTCGCGG AGAACTTCAC 
0121 CCAATGCCTG GCCACGTCGC TCATTGGTGA AAAGTGCGAC GACAGCGTCC AGTGCAATCT 
0181 TATGCCAACG GGGGCCAGTT GTAAAGCCGG GGTCTGCGAT TGCGCCGATG GCCAGAACTA 
0241 TCTGCGTGGC AAGTGTCGCC CACTGAACGG ACTCGGCGAG TCCTGCGAAA CGGACTTGGA 
0301 CTGCTACTTT GGCTACGATC GTGCGTCTGT AAGTTGTCAG CAAAACGTGT GCGGCTGTGC 
0361 AAATGGCTAT TATAACAGAT ATGGAAACAT CTGCCGTCGC AAATCAATGG AAGAAAACGA 
0421 TGCCTGCGTC GTTAACGCGG ACTGTGATGA ACTGGGCGCC GGTGTCGAGT GCGTTGGCCT 
0481 AGTATGCACC TATGTGGACG A 
 in silico PCR Fragment
0001 GCCGTA-TTT TGGCCATGTG AAACCGAGGC GGACTGCACA GCTGACGGTA CTAGCTGCGA 
0061 TTTTGCCAGC GGCCAGTGCG AGTGCTCCAC ATTCGATACG GTGCTCGCGG AGAACTTCAC 
0121 CCAATGCCTG GCCACGTCGC TCATTGGTGA AAAGTGCGAC GACAGCGTCC AGTGCAATCT 
0181 TATGCCAACG GGGGCCAGTT GTAAAGCCGG GGTCTGCGAT TGCGCCGATG GCCAGAACTA 
0241 TCTGCGTGGC AAGTGTCGCC CACTGAACGG ACTCGGCGAG TCCTGCGAAA CGGACTTGGA 
0301 CTGCTACTTT GGCTACGATC GTGCGTCTGT AAGTTGTCAG CAAAACGTGT GCGGCTGTGC 
0361 AAATGGCTAT TATAACAGAT ATGGAAACAT CTGCCGTCGC AAATCAATGG AAGAAAACGA 
0421 TGCCTGCGTC GTTAACGCGG ACTGTGATGA ACTGGGCGCC GGTGTCGAGT GCGTTGGCCT 
0481 AGTATGCACC TATGTGGACG A 
 Assemble Data

7381R-1.IR_full       1   GCCGTANTTTTGGCCATGTGAAACCGAGGCGGACTGCACAGCTGACGGTACTAGCTGCGA 60
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     1   GCCGTA-TTTTGGCCATGTGAAACCGAGGCGGACTGCACAGCTGACGGTACTAGCTGCGA 60


7381R-1.IR_full       61  TTTTGCCAGCGGCCAGTGCGAGTGCTCCACATTCGATACGGTGCTCGCGGAGAACTTCAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     61  TTTTGCCAGCGGCCAGTGCGAGTGCTCCACATTCGATACGGTGCTCGCGGAGAACTTCAC 120


7381R-1.IR_full       121 CCAATGCCTGGCCACGTCGCTCATTGGTGAAAAGTGCGACGACAGCGTCCAGTGCAATCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     121 CCAATGCCTGGCCACGTCGCTCATTGGTGAAAAGTGCGACGACAGCGTCCAGTGCAATCT 180


7381R-1.IR_full       181 TATGCCAACGGGGGCCAGTTGTAAAGCCGGGGTCTGCGATTGCGCCGATGGCCAGAACTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     181 TATGCCAACGGGGGCCAGTTGTAAAGCCGGGGTCTGCGATTGCGCCGATGGCCAGAACTA 240


7381R-1.IR_full       241 TCTGCGTGGCAAGTGTCGCCCACTGAACGGACTCGGCGAGTCCTGCGAAACGGACTTGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     241 TCTGCGTGGCAAGTGTCGCCCACTGAACGGACTCGGCGAGTCCTGCGAAACGGACTTGGA 300


7381R-1.IR_full       301 CTGCTACTTTGGCTACGATCGTGCGTCTGTAAGTTGTCAGCAAAACGTGTGCGGCTGTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     301 CTGCTACTTTGGCTACGATCGTGCGTCTGTAAGTTGTCAGCAAAACGTGTGCGGCTGTGC 360


7381R-1.IR_full       361 AAATGGCTATTATAACAGATATGGAAACATCTGCCGTCGCAAATCAATGGAAGAAAACGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     361 AAATGGCTATTATAACAGATATGGAAACATCTGCCGTCGCAAATCAATGGAAGAAAACGA 420


7381R-1.IR_full       421 TGCCTGCGTCGTTAACGCGGACTGTGATGAACTGGGCGCCGGTGTCGAGTGCGTTGGCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7381R-1.in silico     421 TGCCTGCGTCGTTAACGCGGACTGTGATGAACTGGGCGCCGGTGTCGAGTGCGTTGGCCT 480


7381R-1.IR_full       481 AGTATGCACCTATGTGGACGA 501
                          |||||||||||||||||||||
7381R-1.in silico     481 AGTATGCACCTATGTGGACGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169485.1  CG7381-RB, transcript variant B (CG7381), mRNA 
100   482  NM_141985.1  CG7381-RA, transcript variant A (CG7381), mRNA 
39.62   191  NM_169486.1  CG7381-RC, transcript variant C (CG7381), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_168788.2  CG9655-RB, transcript variant B (nes), mRNA 
0   NM_176349.1  CG9655-RC, transcript variant C (nes), mRNA 
0   NM_079433.2  CG9655-RA, transcript variant A (nes), mRNA 
0   NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   NM_057559.3  CG3656-RA, transcript variant A (Cyp4d1), mRNA 
0   NM_170236.1  CG31096-RA (Lgr3), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   13  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   13  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   13  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_134294.1  CG10334-RC, transcript variant C (spi), mRNA 
0   NM_134295.1  CG10334-RD, transcript variant D (spi), mRNA 
0   NM_134293.2  CG10334-RB, transcript variant B (spi), mRNA 
0   NM_057561.4  CG10334-RF, transcript variant F (spi), mRNA 
0   NM_134292.2  CG10334-RE, transcript variant E (spi), mRNA 
0   NM_001032110.1  CG10334-RG, transcript variant G (spi), mRNA 
0   NM_134291.3  CG10334-RA, transcript variant A (spi), mRNA 
0   NM_078831.1  CG5006-RA (Or33c), mRNA 
0   NM_135814.1  CG16850-RA (CG16850), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.