National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 7375R-3 
 Symbol CG7375  Full Name CG7375 
 CG No CG7375  Old CG No CG7375 
 Synonyms anon-WO0118547.309, CG7375 
 Accession No (Link to NCBI) NM_139930.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Strutt H, Thomas-MacArthur V, Strutt D.
Strabismus promotes recruitment and degradation of farnesylated prickle in Drosophila melanogaster planar polarity specification.
PLoS Genet. (2013) 9(7) e1003654 [ PubMed ID = 23874239 ] [ RRC reference ]

Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTATTCACGCTTAAGCAGCAG 
 Primer Seq. 3'
aatctagaggtaccACAGCCACCACGCATCGCCTT 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 NTATTCACGC TTAAGCAGCA GAAGAAAGAC GGCGAGCAAA AGGGCAGTCA GCAGAAGAAA 
0061 GCGTCCNCCG CCCAGCTGCG CATACAGAAA GATATTAACG AACTGAACCT GCCAAACACT 
0121 TGCGCCACAG ACTTTCCCGA TCCCAATGAC TTGCTCAACT TCAAGCTTAT CATCTCGCCC 
0181 GACGAGGGCT TCTACAGAGA CGGGCGCTTC GTGTTCAATT TCCGCGTCGG ATCCAACTAT 
0241 CCGCACGAGC CGCCCAAGGT GAAGTGCGCC ACCCAGGTGT ACCATCCCAA TATTGACCTG 
0301 GATGGCAACG TCTGCCTCAA CATTCTGCGC GAGGACTGGA ATCCAGTGCT GAACATCAAC 
0361 TCCATCGTCT ATGGCTTGCA GTTTCTATTC TTGGNAACCC AATCCCGAGG ATCCGCTTCA 
0421 ACAAGGGAGG CGGCCGACGG TCCTTGCAGA ACCAACCGCN TCGTCAGTTT CCGAGAAACA 
0481 AATTGTAAAG AAGgNGATGC GTGGTGGCTG T 
 in silico PCR Fragment
0001 CTATTCACGC TTAAGCAGCA GAAGAAAGAC GGCGAGCAAA AGGGCAGTCA GCAGAAGAAA 
0061 GCGTCCGCCG CCCAGCTGCG CATACAGAAA GATATTAACG AACTGAACCT GCCAAACACT 
0121 TGCGCCACAG ACTTTCCCGA TCCCAATGAC TTGCTCAACT TCAAGCTTAT CATCTCGCCC 
0181 GACGAGGGCT TCTACAGAGA CGGGCGCTTC GTGTTCAATT TCCGCGTCGG ATCCAACTAT 
0241 CCGCACGAGC CGCCCAAGGT GAAGTGCGCC ACCCAGGTGT ACCATCCCAA TATTGACCTG 
0301 GATGGCAACG TCTGCCTCAA CATTCTGCGC GAGGACTGGA ATCCAGTGCT GAACATCAAC 
0361 TCCATCGTCT ATGGCTTGCA GTTTCTATTC TTGG-AACCC AATCCCGAGG ATCCGC-TCA 
0421 ACAA-GGAGG CGGCCGAC-G TCC-TGCAG- ACCAACCGC- -CGTCAGTT- -CGAG-AACA 
0481 A--TGTAAAG AAGGCGATGC GTGGTGGCTG T 
 Assemble Data

7375R-3.IR_full        1   TATTCACGCTTAAGCAGCAGAAGAAAGACGGCGAGCAAAAGGGCAGTCAGCAGAAGAAA 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico      1   TATTCACGCTTAAGCAGCAGAAGAAAGACGGCGAGCAAAAGGGCAGTCAGCAGAAGAAA 59


7375R-3.IR_full       61  GCGTCCNCCGCCCAGCTGCGCATACAGAAAGATATTAACGAACTGAACCTGCCAAACACT 119
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico     61  GCGTCCGCCGCCCAGCTGCGCATACAGAAAGATATTAACGAACTGAACCTGCCAAACACT 119


7375R-3.IR_full       121 TGCGCCACAGACTTTCCCGATCCCAATGACTTGCTCAACTTCAAGCTTATCATCTCGCCC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico     121 TGCGCCACAGACTTTCCCGATCCCAATGACTTGCTCAACTTCAAGCTTATCATCTCGCCC 179


7375R-3.IR_full       181 GACGAGGGCTTCTACAGAGACGGGCGCTTCGTGTTCAATTTCCGCGTCGGATCCAACTAT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico     181 GACGAGGGCTTCTACAGAGACGGGCGCTTCGTGTTCAATTTCCGCGTCGGATCCAACTAT 239


7375R-3.IR_full       241 CCGCACGAGCCGCCCAAGGTGAAGTGCGCCACCCAGGTGTACCATCCCAATATTGACCTG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico     241 CCGCACGAGCCGCCCAAGGTGAAGTGCGCCACCCAGGTGTACCATCCCAATATTGACCTG 299


7375R-3.IR_full       301 GATGGCAACGTCTGCCTCAACATTCTGCGCGAGGACTGGAATCCAGTGCTGAACATCAAC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
7375R-3.in silico     301 GATGGCAACGTCTGCCTCAACATTCTGCGCGAGGACTGGAATCCAGTGCTGAACATCAAC 359


7375R-3.IR_full       361 TCCATCGTCTATGGCTTGCAGTTTCTATTCTTGGNAACCCAATCCCGAGGATCCGCTTCA 419
                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||
7375R-3.in silico     361 TCCATCGTCTATGGCTTGCAGTTTCTATTCTTGG-AACCCAATCCCGAGGATCCGC-TCA 419


7375R-3.IR_full       421 ACAAGGGAGGCGGCCGACGGTCCTTGCAGAACCAACCGCNTCGTCAGTTTCCGAGAAACA 479
                          |||| ||||||||||||| |||| ||||| |||||||||  ||||||||  |||| ||||
7375R-3.in silico     421 ACAA-GGAGGCGGCCGAC-GTCC-TGCAG-ACCAACCGC--CGTCAGTT--CGAG-AACA 479


7375R-3.IR_full       481 AATTGTAAAGAAGGNGATGCGTGGTGGCTGT 510
                          |  ||||||||||| ||||||||||||||||
7375R-3.in silico     481 A--TGTAAAGAAGGCGATGCGTGGTGGCTGT 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_139930.1  CG7375-RA (CG7375), mRNA 
0   NM_176309.2  CG33205-RC, transcript variant C (CG33205), mRNA 
0   NM_176312.2  CG33205-RA, transcript variant A (CG33205), mRNA 
0   NM_176308.2  CG33205-RB, transcript variant B (CG33205), mRNA 
0   NM_137412.2  CG6406-RB, transcript variant B (CG6406), mRNA 
0   NM_078595.1  CG18319-RA (ben), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_137686.5  CG9313-RA (CG9313), mRNA 
0   NM_130658.2  CG10260-RB (CG10260), mRNA 
0   NM_136496.2  CG14763-RA (CG14763), mRNA 
0   NM_170348.1  CG31055-RB, transcript variant B (CG31055), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 
0   NM_170346.1  CG31055-RA, transcript variant A (CG31055), mRNA 
0   NM_130518.2  CG3703-RA (CG3703), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_078836.2  CG12403-RA (Vha68-1), mRNA 
0   NM_140154.1  CG12523-RA (CG12523), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_165049.1  CG31814-RA (CG31814), mRNA 
0   NM_001014713.1  CG31814-RA (CG31814), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
0   NM_080294.3  CG31814-RA (CG31814), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_165939.1  CG8772-RD, transcript variant D (nemy), mRNA 
0   NM_165938.1  CG8772-RA, transcript variant A (nemy), mRNA 
0   NM_079307.1  CG7260-RA (byn), mRNA 
0   NM_142240.1  CG14876-RA (CG14876), mRNA 
0   NM_132069.2  CG32754-RA (vanin-like), mRNA 
0   NM_167061.1  CG32751-RA (CG32751), mRNA 
0   NM_132432.1  CG2186-RA (CG2186), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.